ID: 1127679394

View in Genome Browser
Species Human (GRCh38)
Location 15:61278040-61278062
Sequence CTTACCATTGGGTTTAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679386_1127679394 -4 Left 1127679386 15:61278021-61278043 CCTGAGCCACCGCGCCCGGCTTA No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data
1127679383_1127679394 18 Left 1127679383 15:61277999-61278021 CCCAAAATGTTGAGATTACAGGC No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data
1127679387_1127679394 -10 Left 1127679387 15:61278027-61278049 CCACCGCGCCCGGCTTACCATTG No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data
1127679380_1127679394 27 Left 1127679380 15:61277990-61278012 CCTCGGCCTCCCAAAATGTTGAG No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data
1127679384_1127679394 17 Left 1127679384 15:61278000-61278022 CCAAAATGTTGAGATTACAGGCC No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data
1127679381_1127679394 21 Left 1127679381 15:61277996-61278018 CCTCCCAAAATGTTGAGATTACA No data
Right 1127679394 15:61278040-61278062 CTTACCATTGGGTTTAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679394 Original CRISPR CTTACCATTGGGTTTAAGCA GGG Intergenic