ID: 1127679859

View in Genome Browser
Species Human (GRCh38)
Location 15:61282958-61282980
Sequence TACTGTGTGCCGTAAGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127679855_1127679859 6 Left 1127679855 15:61282929-61282951 CCAGAAAGAAACTGGAATCCCAT No data
Right 1127679859 15:61282958-61282980 TACTGTGTGCCGTAAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127679859 Original CRISPR TACTGTGTGCCGTAAGCTGG TGG Intergenic
No off target data available for this crispr