ID: 1127680812

View in Genome Browser
Species Human (GRCh38)
Location 15:61296110-61296132
Sequence CTAGTTCTGGATCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127680812_1127680815 3 Left 1127680812 15:61296110-61296132 CCAAAATCAAGATCCAGAACTAG No data
Right 1127680815 15:61296136-61296158 ATCATCACAAAGCTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127680812 Original CRISPR CTAGTTCTGGATCTTGATTT TGG (reversed) Intergenic
No off target data available for this crispr