ID: 1127680819

View in Genome Browser
Species Human (GRCh38)
Location 15:61296184-61296206
Sequence CTAAAGATGTTGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127680819_1127680826 21 Left 1127680819 15:61296184-61296206 CCTTCTTCCCTCAACATCTTTAG No data
Right 1127680826 15:61296228-61296250 TTCCTCATCTCTATAAATTTGGG No data
1127680819_1127680825 20 Left 1127680819 15:61296184-61296206 CCTTCTTCCCTCAACATCTTTAG No data
Right 1127680825 15:61296227-61296249 GTTCCTCATCTCTATAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127680819 Original CRISPR CTAAAGATGTTGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr