ID: 1127683098

View in Genome Browser
Species Human (GRCh38)
Location 15:61316490-61316512
Sequence TGCCATGACAAGAGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127683098_1127683106 25 Left 1127683098 15:61316490-61316512 CCCCTCCCACTCTTGTCATGGCA No data
Right 1127683106 15:61316538-61316560 AGGAGCACGCACCTTCCTGCAGG No data
1127683098_1127683103 5 Left 1127683098 15:61316490-61316512 CCCCTCCCACTCTTGTCATGGCA No data
Right 1127683103 15:61316518-61316540 ACAACAAGTCGCCTCCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127683098 Original CRISPR TGCCATGACAAGAGTGGGAG GGG (reversed) Intergenic
No off target data available for this crispr