ID: 1127691031

View in Genome Browser
Species Human (GRCh38)
Location 15:61398121-61398143
Sequence CTCTGTGATGTAGAGTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127691031_1127691038 20 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691038 15:61398164-61398186 AAAGATCTTCCTGGAAAGGGTGG No data
1127691031_1127691039 28 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691039 15:61398172-61398194 TCCTGGAAAGGGTGGAGTAAAGG No data
1127691031_1127691041 29 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691041 15:61398173-61398195 CCTGGAAAGGGTGGAGTAAAGGG No data
1127691031_1127691034 -8 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691034 15:61398136-61398158 TCACAGAGTCAAAGGTGTTTGGG No data
1127691031_1127691033 -9 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691033 15:61398135-61398157 ATCACAGAGTCAAAGGTGTTTGG No data
1127691031_1127691037 17 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691037 15:61398161-61398183 CACAAAGATCTTCCTGGAAAGGG No data
1127691031_1127691036 16 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691036 15:61398160-61398182 GCACAAAGATCTTCCTGGAAAGG No data
1127691031_1127691035 11 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691035 15:61398155-61398177 TGGGAGCACAAAGATCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127691031 Original CRISPR CTCTGTGATGTAGAGTCCTT TGG (reversed) Intergenic
No off target data available for this crispr