ID: 1127691037

View in Genome Browser
Species Human (GRCh38)
Location 15:61398161-61398183
Sequence CACAAAGATCTTCCTGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127691031_1127691037 17 Left 1127691031 15:61398121-61398143 CCAAAGGACTCTACATCACAGAG No data
Right 1127691037 15:61398161-61398183 CACAAAGATCTTCCTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127691037 Original CRISPR CACAAAGATCTTCCTGGAAA GGG Intergenic
No off target data available for this crispr