ID: 1127700580

View in Genome Browser
Species Human (GRCh38)
Location 15:61496331-61496353
Sequence TATGCCTCCTGGGACTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127700580_1127700583 -4 Left 1127700580 15:61496331-61496353 CCAGGTGAGTCCCAGGAGGCATA No data
Right 1127700583 15:61496350-61496372 CATAGCATGTGCTATCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127700580 Original CRISPR TATGCCTCCTGGGACTCACC TGG (reversed) Intergenic
No off target data available for this crispr