ID: 1127707356

View in Genome Browser
Species Human (GRCh38)
Location 15:61560393-61560415
Sequence GGATGGACAGAAGTTCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127707349_1127707356 3 Left 1127707349 15:61560367-61560389 CCAGGCTCTGAGGCCAGGAGAGA No data
Right 1127707356 15:61560393-61560415 GGATGGACAGAAGTTCAGGTAGG No data
1127707354_1127707356 -10 Left 1127707354 15:61560380-61560402 CCAGGAGAGAAGGGGATGGACAG No data
Right 1127707356 15:61560393-61560415 GGATGGACAGAAGTTCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127707356 Original CRISPR GGATGGACAGAAGTTCAGGT AGG Intergenic
No off target data available for this crispr