ID: 1127708669

View in Genome Browser
Species Human (GRCh38)
Location 15:61573502-61573524
Sequence AATCTGTGGATAAGAATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127708669_1127708672 6 Left 1127708669 15:61573502-61573524 CCAGGAATTCTTATCCACAGATT No data
Right 1127708672 15:61573531-61573553 GAGGAACTCAAGACTCAAATAGG No data
1127708669_1127708673 12 Left 1127708669 15:61573502-61573524 CCAGGAATTCTTATCCACAGATT No data
Right 1127708673 15:61573537-61573559 CTCAAGACTCAAATAGGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127708669 Original CRISPR AATCTGTGGATAAGAATTCC TGG (reversed) Intergenic
No off target data available for this crispr