ID: 1127708673

View in Genome Browser
Species Human (GRCh38)
Location 15:61573537-61573559
Sequence CTCAAGACTCAAATAGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127708671_1127708673 -2 Left 1127708671 15:61573516-61573538 CCACAGATTTTAAATGAGGAACT No data
Right 1127708673 15:61573537-61573559 CTCAAGACTCAAATAGGTTAAGG No data
1127708669_1127708673 12 Left 1127708669 15:61573502-61573524 CCAGGAATTCTTATCCACAGATT No data
Right 1127708673 15:61573537-61573559 CTCAAGACTCAAATAGGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127708673 Original CRISPR CTCAAGACTCAAATAGGTTA AGG Intergenic
No off target data available for this crispr