ID: 1127713401

View in Genome Browser
Species Human (GRCh38)
Location 15:61624041-61624063
Sequence GGCACCGTTTCCCGAGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127713401_1127713404 -2 Left 1127713401 15:61624041-61624063 CCAAGGGCTCGGGAAACGGTGCC No data
Right 1127713404 15:61624062-61624084 CCGAGACGAGCGGCCTGTACAGG No data
1127713401_1127713405 7 Left 1127713401 15:61624041-61624063 CCAAGGGCTCGGGAAACGGTGCC No data
Right 1127713405 15:61624071-61624093 GCGGCCTGTACAGGTTAAGTAGG No data
1127713401_1127713406 8 Left 1127713401 15:61624041-61624063 CCAAGGGCTCGGGAAACGGTGCC No data
Right 1127713406 15:61624072-61624094 CGGCCTGTACAGGTTAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127713401 Original CRISPR GGCACCGTTTCCCGAGCCCT TGG (reversed) Intergenic