ID: 1127713406

View in Genome Browser
Species Human (GRCh38)
Location 15:61624072-61624094
Sequence CGGCCTGTACAGGTTAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127713401_1127713406 8 Left 1127713401 15:61624041-61624063 CCAAGGGCTCGGGAAACGGTGCC No data
Right 1127713406 15:61624072-61624094 CGGCCTGTACAGGTTAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127713406 Original CRISPR CGGCCTGTACAGGTTAAGTA GGG Intergenic