ID: 1127717307

View in Genome Browser
Species Human (GRCh38)
Location 15:61661718-61661740
Sequence CAGGTTTGGAAGGATGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127717307_1127717312 10 Left 1127717307 15:61661718-61661740 CCTCCAGCATCCTTCCAAACCTG No data
Right 1127717312 15:61661751-61661773 GCCGCTCTGCAGAGCCACTGTGG No data
1127717307_1127717315 30 Left 1127717307 15:61661718-61661740 CCTCCAGCATCCTTCCAAACCTG No data
Right 1127717315 15:61661771-61661793 TGGCTAACTTTTTAAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127717307 Original CRISPR CAGGTTTGGAAGGATGCTGG AGG (reversed) Intergenic
No off target data available for this crispr