ID: 1127717618

View in Genome Browser
Species Human (GRCh38)
Location 15:61664975-61664997
Sequence GAGTTAATAGGGATAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127717615_1127717618 17 Left 1127717615 15:61664935-61664957 CCAAACAGTTAGAAGCTTCTACA No data
Right 1127717618 15:61664975-61664997 GAGTTAATAGGGATAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127717618 Original CRISPR GAGTTAATAGGGATAGAACA TGG Intergenic
No off target data available for this crispr