ID: 1127722933

View in Genome Browser
Species Human (GRCh38)
Location 15:61720548-61720570
Sequence GACAAGAGGTGGGTACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127722933_1127722939 4 Left 1127722933 15:61720548-61720570 CCTTCATGTACCCACCTCTTGTC No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data
1127722933_1127722937 1 Left 1127722933 15:61720548-61720570 CCTTCATGTACCCACCTCTTGTC No data
Right 1127722937 15:61720572-61720594 GCCAGCCCGACAATCACCTTCGG No data
1127722933_1127722942 8 Left 1127722933 15:61720548-61720570 CCTTCATGTACCCACCTCTTGTC No data
Right 1127722942 15:61720579-61720601 CGACAATCACCTTCGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127722933 Original CRISPR GACAAGAGGTGGGTACATGA AGG (reversed) Intergenic
No off target data available for this crispr