ID: 1127722934

View in Genome Browser
Species Human (GRCh38)
Location 15:61720558-61720580
Sequence CGGGCTGGCTGACAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127722934_1127722944 28 Left 1127722934 15:61720558-61720580 CCCACCTCTTGTCAGCCAGCCCG No data
Right 1127722944 15:61720609-61720631 ATCCTTCTCACTAGATATTTTGG No data
1127722934_1127722945 29 Left 1127722934 15:61720558-61720580 CCCACCTCTTGTCAGCCAGCCCG No data
Right 1127722945 15:61720610-61720632 TCCTTCTCACTAGATATTTTGGG No data
1127722934_1127722939 -6 Left 1127722934 15:61720558-61720580 CCCACCTCTTGTCAGCCAGCCCG No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data
1127722934_1127722937 -9 Left 1127722934 15:61720558-61720580 CCCACCTCTTGTCAGCCAGCCCG No data
Right 1127722937 15:61720572-61720594 GCCAGCCCGACAATCACCTTCGG No data
1127722934_1127722942 -2 Left 1127722934 15:61720558-61720580 CCCACCTCTTGTCAGCCAGCCCG No data
Right 1127722942 15:61720579-61720601 CGACAATCACCTTCGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127722934 Original CRISPR CGGGCTGGCTGACAAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr