ID: 1127722935

View in Genome Browser
Species Human (GRCh38)
Location 15:61720559-61720581
Sequence TCGGGCTGGCTGACAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127722935_1127722944 27 Left 1127722935 15:61720559-61720581 CCACCTCTTGTCAGCCAGCCCGA No data
Right 1127722944 15:61720609-61720631 ATCCTTCTCACTAGATATTTTGG No data
1127722935_1127722939 -7 Left 1127722935 15:61720559-61720581 CCACCTCTTGTCAGCCAGCCCGA No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data
1127722935_1127722942 -3 Left 1127722935 15:61720559-61720581 CCACCTCTTGTCAGCCAGCCCGA No data
Right 1127722942 15:61720579-61720601 CGACAATCACCTTCGGTGGAAGG No data
1127722935_1127722937 -10 Left 1127722935 15:61720559-61720581 CCACCTCTTGTCAGCCAGCCCGA No data
Right 1127722937 15:61720572-61720594 GCCAGCCCGACAATCACCTTCGG No data
1127722935_1127722945 28 Left 1127722935 15:61720559-61720581 CCACCTCTTGTCAGCCAGCCCGA No data
Right 1127722945 15:61720610-61720632 TCCTTCTCACTAGATATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127722935 Original CRISPR TCGGGCTGGCTGACAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr