ID: 1127722939

View in Genome Browser
Species Human (GRCh38)
Location 15:61720575-61720597
Sequence AGCCCGACAATCACCTTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127722936_1127722939 -10 Left 1127722936 15:61720562-61720584 CCTCTTGTCAGCCAGCCCGACAA No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data
1127722932_1127722939 12 Left 1127722932 15:61720540-61720562 CCAAGATGCCTTCATGTACCCAC No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data
1127722933_1127722939 4 Left 1127722933 15:61720548-61720570 CCTTCATGTACCCACCTCTTGTC No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data
1127722934_1127722939 -6 Left 1127722934 15:61720558-61720580 CCCACCTCTTGTCAGCCAGCCCG No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data
1127722935_1127722939 -7 Left 1127722935 15:61720559-61720581 CCACCTCTTGTCAGCCAGCCCGA No data
Right 1127722939 15:61720575-61720597 AGCCCGACAATCACCTTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127722939 Original CRISPR AGCCCGACAATCACCTTCGG TGG Intergenic
No off target data available for this crispr