ID: 1127726940

View in Genome Browser
Species Human (GRCh38)
Location 15:61759605-61759627
Sequence TTGTAACCACACATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127726940_1127726943 4 Left 1127726940 15:61759605-61759627 CCCAGCTGCATGTGTGGTTACAA No data
Right 1127726943 15:61759632-61759654 AGCTTTCTCTAATTTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127726940 Original CRISPR TTGTAACCACACATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr