ID: 1127727628

View in Genome Browser
Species Human (GRCh38)
Location 15:61765718-61765740
Sequence CTGCTCAGGCAGATCTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127727626_1127727628 1 Left 1127727626 15:61765694-61765716 CCAAATACATAAACAATTCAAAA No data
Right 1127727628 15:61765718-61765740 CTGCTCAGGCAGATCTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127727628 Original CRISPR CTGCTCAGGCAGATCTGAAA AGG Intergenic
No off target data available for this crispr