ID: 1127728007

View in Genome Browser
Species Human (GRCh38)
Location 15:61769849-61769871
Sequence CCTGATGTGCAGAGGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127728007_1127728015 -3 Left 1127728007 15:61769849-61769871 CCTGAATCCCTCTGCACATCAGG No data
Right 1127728015 15:61769869-61769891 AGGGTTGCCCTGGGAAAATTGGG No data
1127728007_1127728016 -2 Left 1127728007 15:61769849-61769871 CCTGAATCCCTCTGCACATCAGG No data
Right 1127728016 15:61769870-61769892 GGGTTGCCCTGGGAAAATTGGGG No data
1127728007_1127728017 3 Left 1127728007 15:61769849-61769871 CCTGAATCCCTCTGCACATCAGG No data
Right 1127728017 15:61769875-61769897 GCCCTGGGAAAATTGGGGAGAGG No data
1127728007_1127728014 -4 Left 1127728007 15:61769849-61769871 CCTGAATCCCTCTGCACATCAGG No data
Right 1127728014 15:61769868-61769890 CAGGGTTGCCCTGGGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127728007 Original CRISPR CCTGATGTGCAGAGGGATTC AGG (reversed) Intergenic
No off target data available for this crispr