ID: 1127739844

View in Genome Browser
Species Human (GRCh38)
Location 15:61892261-61892283
Sequence GTTCAGCAGCACAACACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 8, 2: 26, 3: 46, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127739840_1127739844 5 Left 1127739840 15:61892233-61892255 CCAAAGGAAACGCCTATTCAGAG 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG 0: 1
1: 8
2: 26
3: 46
4: 167
1127739842_1127739844 -7 Left 1127739842 15:61892245-61892267 CCTATTCAGAGTGGCTGTTCAGC 0: 1
1: 25
2: 69
3: 64
4: 149
Right 1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG 0: 1
1: 8
2: 26
3: 46
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127739844 Original CRISPR GTTCAGCAGCACAACACTGT GGG Intronic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
905297632 1:36964184-36964206 GTACAGCAGCCCAACACAGTTGG - Intronic
907878979 1:58525768-58525790 ATTCTGCAGAACAACACTGGAGG + Intronic
908155887 1:61352689-61352711 GTTCAGCCCCAAAAGACTGTCGG + Intronic
911764104 1:101653712-101653734 GTTTAGCAGCATAATACTGTAGG - Intergenic
912640665 1:111342537-111342559 GTTCAGCAGTGCAAAGCTGTAGG - Intergenic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918479002 1:184957028-184957050 GTTTACCAGCACATCACTGCTGG - Intronic
918719019 1:187828696-187828718 GTTCATGAGGACAAGACTGTGGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074427886 10:113368283-113368305 GTACTGCACCAGAACACTGTTGG + Intergenic
1074893796 10:117757439-117757461 GTTCAGCAGCCCAAGGCTGAGGG - Intergenic
1075056397 10:119222058-119222080 GATCATCAGCACAACCCTGTGGG + Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080923985 11:36737185-36737207 GTTAAGCAGCAGTACCCTGTAGG - Intergenic
1081742090 11:45448014-45448036 GTTCAGCAGAAAGACACTGGAGG + Intergenic
1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG + Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1087709483 11:101532666-101532688 TTTCACCAGCAAAACAATGTTGG - Intronic
1090276881 11:125426458-125426480 GTTCACCAGCCCACAACTGTTGG - Intronic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092735717 12:11580611-11580633 GCTCAGTAGCAAAACTCTGTGGG + Intergenic
1092793715 12:12090800-12090822 TTTCAGCAGCTCAACAATTTTGG - Exonic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093318578 12:17683217-17683239 GTTCATCATCTTAACACTGTAGG + Intergenic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103506142 12:121443327-121443349 GTTCTGGAGCACAGCCCTGTGGG + Intronic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1106525804 13:30540342-30540364 TTTGAGCAGCACGACACTGGGGG + Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109480517 13:62946037-62946059 TTTCTGCAGCACGACACTCTTGG + Intergenic
1110327516 13:74234285-74234307 GTGAAGCAGCATAACACAGTGGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1113282376 13:108803159-108803181 TTTCAACAGCAAAACACTCTTGG - Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115976953 14:39007257-39007279 GTTAAGAAACAGAACACTGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119101137 14:71880983-71881005 GTGGAGCAGCCCAAGACTGTGGG + Intergenic
1119754447 14:77105156-77105178 TTTGAGAAACACAACACTGTGGG + Intronic
1119966350 14:78920655-78920677 GGTCAGCTGCACAAAACTGTGGG - Intronic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1129842377 15:78751745-78751767 GTTCTGCAGCACAGGAGTGTTGG + Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1130302749 15:82692420-82692442 GCTCAGCCGCACTGCACTGTGGG + Intronic
1132172840 15:99680090-99680112 CTTCAGCAGCTCAACACTGAGGG - Intronic
1137821222 16:51447940-51447962 GTTGAGCAGCACAAAATTCTAGG + Intergenic
1138986291 16:62332664-62332686 GTTCAGCTGTAGAAAACTGTAGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1140899027 16:79351262-79351284 GTTCAGCAACACACCTCTCTGGG - Intergenic
1141386310 16:83625099-83625121 ATTTACCAGCACAATACTGTGGG + Intronic
1144710144 17:17396131-17396153 GTGCCGCAGCACAGCACTGCTGG - Intergenic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1145185079 17:20787149-20787171 GTGAAGGGGCACAACACTGTGGG - Intergenic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1150911410 17:69391288-69391310 GTTCTACAGCACAACACCATTGG + Intergenic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1154009416 18:10562315-10562337 GTTCCTCAGTAAAACACTGTGGG + Intergenic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1158250111 18:55478502-55478524 GTTCAGCTACTCAAAACTGTTGG + Intronic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1160813084 19:1021403-1021425 GTTCTGCAACATACCACTGTAGG + Intergenic
1161033285 19:2069891-2069913 GTGCAGCAGCACAGCGCTGACGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166175681 19:41067828-41067850 ATTTACCAGCACAACCCTGTGGG + Intergenic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926767831 2:16337920-16337942 GTTAAGCAACACATGACTGTAGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927888812 2:26735539-26735561 GATCATCAGAACAACACTGTGGG + Intergenic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
936013025 2:108937012-108937034 GTTCCCCGGCACAGCACTGTGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
947387879 2:229610259-229610281 TTTCTGCAGCACGACACAGTGGG - Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1169508581 20:6240009-6240031 GGTGAGCAGCACATCCCTGTGGG - Intergenic
1170075016 20:12409958-12409980 GTGCAGCTTCACACCACTGTGGG - Intergenic
1170349918 20:15427652-15427674 GCTCATCAGTACAACACTGAAGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1174274211 20:49391859-49391881 GTGCAGCAGGACACCACTGGAGG - Intronic
1177104841 21:16943030-16943052 GTTCAGCGGCACTATACTATAGG - Intergenic
1179391934 21:41001848-41001870 GTTAAAAAGCAAAACACTGTAGG - Intergenic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
1183811814 22:40264081-40264103 ATTCAGCAGGAAAACACAGTAGG + Intronic
951318881 3:21220993-21221015 TTAAAGCAGCACAACACTGTAGG - Intergenic
951811143 3:26701461-26701483 CTCCAGCAACACAAAACTGTAGG - Intronic
951923306 3:27879284-27879306 GTTCTGAAGCACTACACTGGTGG + Intergenic
952071502 3:29642606-29642628 GGACAGCAGAACAAGACTGTGGG + Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
955077456 3:55627132-55627154 CTTCAGCTCCACAAAACTGTTGG + Intronic
955122220 3:56072001-56072023 GTGCAGCAGCCATACACTGTTGG + Intronic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
958057220 3:88428056-88428078 GTAGAGCTGCACAAGACTGTGGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
964374806 3:156039117-156039139 GTTTAGCAGGACAAGTCTGTTGG + Intronic
964537124 3:157735175-157735197 GTTCAGCAGCTTCACACAGTAGG + Intergenic
964846917 3:161054324-161054346 GTTCAGCAGAACAGCACATTAGG - Intronic
965802316 3:172507271-172507293 GTTCACCAGCACAAGACGGGAGG - Intronic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
967152652 3:186663990-186664012 TCTCAGCAGAACAGCACTGTAGG + Intronic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
969430767 4:7152775-7152797 ATTCAGCACCACAAAAGTGTGGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
971381075 4:26098405-26098427 TTTCAGAAGCACAGCTCTGTAGG + Intergenic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972227686 4:37032745-37032767 GTTCTGCATCATGACACTGTGGG - Intergenic
977519922 4:98068993-98069015 ATTATGCAGCACAAGACTGTAGG + Intronic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
978969068 4:114780532-114780554 GTTCAATAGCACCACACTATAGG - Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980630207 4:135421578-135421600 GTTCTGCAGCAGAATTCTGTGGG + Intergenic
980728088 4:136790576-136790598 GTTCAGCAGCACAATATTTCTGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
983698635 4:170564315-170564337 GTTCAGCAGCACAGCTCTCTTGG + Intergenic
984521249 4:180803753-180803775 TTCCAGCAGCACAATGCTGTTGG - Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
987026118 5:13928458-13928480 CTTCAACAGCTCAACACTTTAGG - Intronic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
991965412 5:72085890-72085912 GTTCAGAATCACAAAACTGCAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997096003 5:130912121-130912143 ATTCATCAGCCCAATACTGTAGG + Intergenic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999969765 5:156847612-156847634 ATTCAGCAGCAGTACATTGTAGG + Intergenic
1001579450 5:172789057-172789079 GCTCAGCAGCTCAGCCCTGTGGG - Intergenic
1002922806 6:1585196-1585218 GATCAACAGCACAAGAGTGTTGG + Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003590867 6:7435581-7435603 ATTTAGCAGTACGACACTGTAGG + Intergenic
1007367012 6:41401609-41401631 GTTTACCAGCACACCACTGTTGG + Intergenic
1007982813 6:46176420-46176442 ATTAAGCAGCAGATCACTGTAGG + Intergenic
1012536530 6:100304895-100304917 GTTCAGCAGCTCAGCAACGTGGG - Intergenic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1016651129 6:146462228-146462250 ATTCAGTAGCACTGCACTGTTGG - Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1020016406 7:4834482-4834504 GCTCAGCAGCACAGCACCGTGGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1024315692 7:48014633-48014655 GATCTGCAGCAGAAGACTGTGGG + Intronic
1027603046 7:80263343-80263365 GTTCAACAAGACGACACTGTGGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1031249490 7:119361953-119361975 GTTCAGGAACAAATCACTGTGGG - Intergenic
1032057889 7:128698194-128698216 GTTGAGAACCACAACACTGGAGG + Intergenic
1034457118 7:151176602-151176624 GGGAAGCTGCACAACACTGTAGG + Exonic
1034594605 7:152177789-152177811 GTTCAGCAGCACAACATACTGGG - Exonic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1035319087 7:158016916-158016938 GTGCAGCAGCAGGGCACTGTAGG - Intronic
1038024503 8:23576674-23576696 GTTCATCAGCACACCACTGCTGG + Intergenic
1042002341 8:64138699-64138721 ATTCAGCAGCACTGTACTGTAGG + Intergenic
1043063799 8:75540637-75540659 GTTTAGCCGCACAAAGCTGTTGG + Intronic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1043982598 8:86658714-86658736 GATCACCAGCACACCACAGTCGG - Intronic
1044144609 8:88696299-88696321 GTTCGGCAACACTACACTGCAGG - Intergenic
1044160681 8:88910789-88910811 CTTCCTCAGCACAACACTCTGGG + Intergenic
1045908927 8:107382499-107382521 ATTTATCAGCACAGCACTGTTGG - Intronic
1047476657 8:125238851-125238873 GTTCTGCAGTAAGACACTGTGGG + Intronic
1047697886 8:127420948-127420970 GTTCATCAGCACAAAGCTGGAGG + Intergenic
1048133538 8:131723295-131723317 GTTCAGCTAAACTACACTGTTGG + Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055444878 9:76372662-76372684 GTTCAGAAGCAAATCACTTTGGG - Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1056573580 9:87837127-87837149 GTACAGTAGCACAACCCTGGTGG - Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057841180 9:98486626-98486648 TTTCAGCAGCCCAGCACAGTAGG - Intronic
1059031402 9:110701266-110701288 GTACAGCAGAGCAACACTGGAGG - Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1186561865 X:10621263-10621285 GTTCAACAGATCAACCCTGTAGG - Intronic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187942167 X:24392716-24392738 TGTCAGCAGCAGACCACTGTTGG + Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190234763 X:48606827-48606849 GTTCAGCAGCTCAGCAATGCTGG - Exonic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1193979877 X:88169061-88169083 GTGCACCAGCAAAACAGTGTGGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194597828 X:95880833-95880855 GCTCAGCATCACAAATCTGTAGG - Intergenic
1194666623 X:96683968-96683990 GTGCAGCAGCAGGGCACTGTTGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196816563 X:119669714-119669736 GTTGACCAGCACACCACTGCTGG + Intronic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1199787571 X:151118637-151118659 CTTCCCCAACACAACACTGTTGG - Intergenic