ID: 1127739844

View in Genome Browser
Species Human (GRCh38)
Location 15:61892261-61892283
Sequence GTTCAGCAGCACAACACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 8, 2: 26, 3: 46, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127739842_1127739844 -7 Left 1127739842 15:61892245-61892267 CCTATTCAGAGTGGCTGTTCAGC 0: 1
1: 25
2: 69
3: 64
4: 149
Right 1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG 0: 1
1: 8
2: 26
3: 46
4: 167
1127739840_1127739844 5 Left 1127739840 15:61892233-61892255 CCAAAGGAAACGCCTATTCAGAG 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG 0: 1
1: 8
2: 26
3: 46
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127739844 Original CRISPR GTTCAGCAGCACAACACTGT GGG Intronic