ID: 1127742488

View in Genome Browser
Species Human (GRCh38)
Location 15:61925190-61925212
Sequence CTATTTGCATGCGTGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127742488 Original CRISPR CTATTTGCATGCGTGTGTTG TGG (reversed) Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
901393445 1:8963366-8963388 GTGTTTGCATGGGAGTGTTGAGG - Intronic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
909106578 1:71417593-71417615 CTATTTGAATGTGTTTGTTATGG + Intronic
911519498 1:98911598-98911620 TTATTTGCATGAGTGTTTTTTGG - Intronic
915116571 1:153604811-153604833 CTATTTCCATAAGTGTGGTGTGG - Intergenic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
918391659 1:184070242-184070264 GTGTTTGTATGTGTGTGTTGGGG - Intronic
919423465 1:197400973-197400995 GTATATGTATGTGTGTGTTGGGG - Intronic
919780143 1:201216231-201216253 CTGGGTGCATGTGTGTGTTGGGG + Intronic
920406391 1:205715919-205715941 CTATTTGCATGCATGATTTGAGG + Exonic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
924032227 1:239897201-239897223 CTATCTGCGTGCATGAGTTGGGG + Intronic
1063319697 10:5041238-5041260 CCATTTGCCAGAGTGTGTTGGGG + Intronic
1064088617 10:12364641-12364663 CTCTGTGCATGCATGTGTTATGG + Intronic
1065681543 10:28238935-28238957 TGTTCTGCATGCGTGTGTTGAGG + Intronic
1065714363 10:28550528-28550550 CGATTTGTATGTGTGTGTGGAGG + Intronic
1066819350 10:39466215-39466237 CTATATGTATGCGTGGGGTGTGG + Intergenic
1067792318 10:49297796-49297818 CTTTTGGCATGCGTTTGTTTTGG + Intergenic
1068561382 10:58518572-58518594 CTTTGTGTATGTGTGTGTTGGGG + Intronic
1071350381 10:84734758-84734780 CTATTTGCATGTTTGTGTGTGGG + Intergenic
1071792020 10:88964969-88964991 CTATATGAATTTGTGTGTTGTGG - Intronic
1073670467 10:105581898-105581920 CTATTTGCCTGCTTGTTTGGTGG - Intergenic
1074445806 10:113520133-113520155 CAACTTGCATGAGTGTCTTGGGG - Intergenic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078476885 11:11638054-11638076 CTATTAGTATGTGTGTGTTGAGG - Intergenic
1078857634 11:15219607-15219629 CTATCTCCAAGCATGTGTTGGGG + Intronic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1079126812 11:17723124-17723146 CTCATGGCACGCGTGTGTTGGGG - Intergenic
1085366154 11:75947030-75947052 CTTCTTGCATGCGTGTGGAGAGG + Intronic
1085402621 11:76243680-76243702 CTAGCTGCAGGCGTGTGTAGGGG + Intergenic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1087232657 11:95683632-95683654 GTATATGCATGCGTGTGTAGGGG - Intergenic
1088382159 11:109205460-109205482 ATATTTACATGAGAGTGTTGTGG + Intergenic
1089088761 11:115848277-115848299 CTATTTACCTGCCTGTGCTGTGG + Intergenic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093342204 12:17991835-17991857 ATGTTTACATGCGTGTGTTGGGG + Intergenic
1093765902 12:22962287-22962309 ATGTTTGCATGTGAGTGTTGGGG + Intergenic
1097053733 12:56238307-56238329 CTGTGTGCAGGTGTGTGTTGGGG - Exonic
1102464271 12:113119384-113119406 CCATTTGCACGTGTGTTTTGGGG - Exonic
1104302221 12:127574785-127574807 CTATTTGCATTCTTGTTCTGTGG + Intergenic
1106512088 13:30421331-30421353 CTATTTGGATGCCTGTGCAGAGG - Intergenic
1106851345 13:33796336-33796358 CCATTTGATTGGGTGTGTTGTGG - Intergenic
1108110399 13:47065402-47065424 GTACTTGCTTGGGTGTGTTGTGG + Intergenic
1108669854 13:52674882-52674904 CTATGTGATTGTGTGTGTTGGGG + Intronic
1109034837 13:57242949-57242971 ATACTTGCATGAGTGTGGTGAGG + Intergenic
1111507442 13:89212049-89212071 CTATGTGTGTGTGTGTGTTGGGG - Intergenic
1112696001 13:101949017-101949039 CCAGTTGTATGGGTGTGTTGGGG + Intronic
1114210229 14:20607854-20607876 GTATGTGGCTGCGTGTGTTGCGG - Intronic
1114812993 14:25922610-25922632 CTATTTGAATAGGTGTGTTGGGG + Intergenic
1115287131 14:31727063-31727085 CTATTAGCATGGGTGTGTTCTGG - Intronic
1117457083 14:55908934-55908956 ATCTTTGCATGTGTGGGTTGTGG + Intergenic
1119144812 14:72302661-72302683 GTATGTGTATGTGTGTGTTGGGG - Intronic
1120860533 14:89251249-89251271 GTACTTGCATGGGTGTGCTGTGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1131381776 15:91970271-91970293 ATATTTGCATGCCTGTCTTTGGG + Intronic
1135111410 16:19693267-19693289 GTATGTGGATGTGTGTGTTGCGG + Intronic
1136013602 16:27381173-27381195 CTGTTTTCATTTGTGTGTTGTGG + Intergenic
1141670651 16:85490075-85490097 CTATTTGCAGTCCTGTGTTATGG + Intergenic
1141983439 16:87564145-87564167 GCATTTGTGTGCGTGTGTTGGGG + Intergenic
1141983444 16:87564208-87564230 CTGTGTGCGTGCTTGTGTTGGGG + Intergenic
1143202082 17:5120239-5120261 CTCTCTGCATGCCTGTGCTGTGG + Intronic
1144178692 17:12732293-12732315 CCATTAGCATGCTTGGGTTGGGG - Intronic
1144384161 17:14733543-14733565 CTATTTGCATGCTGGTTTGGGGG + Intergenic
1144627341 17:16850919-16850941 CTTTTTGCATGCCTGTGCTTTGG - Intergenic
1144879096 17:18421793-18421815 CTTTTTGCATGCCTGTGCTGTGG + Intergenic
1145153138 17:20522594-20522616 CTTTTTGCATGCCTGTGCTGTGG - Intergenic
1146795120 17:35775132-35775154 GTATGTGCATGTGTGTGTTTGGG + Intronic
1147581477 17:41629595-41629617 CTTTCTGCATGCCTGTGCTGTGG - Intergenic
1153580416 18:6567896-6567918 ATATTTTCATCCATGTGTTGAGG + Intronic
1155517028 18:26634409-26634431 ATATATGCATGTGTGTGTTGTGG + Intronic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1157578954 18:48762327-48762349 CTATCAGCATGAGTGTGTCGTGG + Intronic
1168311447 19:55463035-55463057 CTGTGTGCATGTGTGTGTTTTGG - Intergenic
929678930 2:43968869-43968891 CTGTGTGCATGAGTGTGGTGAGG - Intronic
929756884 2:44774000-44774022 CAATTTGTATTTGTGTGTTGTGG + Intergenic
930417022 2:51102204-51102226 CAAGTTGCATGTGTGTGTTCTGG + Intergenic
931457807 2:62425880-62425902 ATATGTGCATGTGTGTGGTGAGG - Intergenic
937413932 2:121699460-121699482 CTATTTGTATGTGTGTGTGTGGG - Intergenic
938119648 2:128624585-128624607 ATATGTGCATGCGTGTGGTGTGG - Intergenic
942406667 2:175663246-175663268 CTATGTGCACGTGTGTGTGGAGG - Intergenic
947268141 2:228304888-228304910 TTATTTGCTTGGGTGTTTTGGGG + Intergenic
947461655 2:230309035-230309057 GTATTTGCATCCACGTGTTGTGG - Intronic
947470738 2:230399237-230399259 GTATTTGCATCCATGTGTTGTGG - Intronic
948544702 2:238719060-238719082 GTATTTGTGTGCCTGTGTTGGGG - Intergenic
949081761 2:242106392-242106414 CTATTTACATCAGTGTGATGAGG - Intergenic
1169241012 20:3980949-3980971 CAATTTGTGTGTGTGTGTTGGGG + Intronic
1172371136 20:34393071-34393093 CTGTTAGCATGCATGAGTTGGGG - Intronic
1172739352 20:37153481-37153503 TTTTGTGCATGAGTGTGTTGGGG - Intronic
1173969379 20:47139853-47139875 AAGTTTGCATGTGTGTGTTGGGG - Intronic
1174626739 20:51921412-51921434 TTATATGCATGTGTTTGTTGTGG - Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1178683784 21:34695605-34695627 TTATTTGCTTGGCTGTGTTGGGG + Intronic
949276275 3:2286243-2286265 GTATTTGTATGTGTATGTTGTGG - Intronic
954633707 3:52060158-52060180 CCATATGAATGTGTGTGTTGGGG - Intergenic
958640615 3:96800437-96800459 CTATTTGGATGGGTTTCTTGTGG + Intergenic
958824535 3:99014581-99014603 CTATTTGAATGGGTATGTAGTGG + Intergenic
961021999 3:123515735-123515757 ATATTTGGATGAGTATGTTGGGG + Intronic
962269787 3:133969113-133969135 CTATTTGCCTGCCCTTGTTGTGG - Intronic
962619571 3:137163897-137163919 TTATGTGCTTGCGTGTGTTTAGG - Intergenic
962733434 3:138303427-138303449 CTATGTGCTTGAGTGTGTGGGGG - Intronic
963720523 3:148857101-148857123 GTTTTTGCATGCGTGTGTTTTGG + Intronic
964226095 3:154404219-154404241 CTATTTGTGTGGGTGTGTGGTGG + Intronic
964890329 3:161527077-161527099 ATATTTGCATATGGGTGTTGAGG + Intergenic
965427668 3:168547041-168547063 CTATTTGAGGGCGTGTGTAGTGG + Intergenic
972104874 4:35470990-35471012 ATATTTGTGTGTGTGTGTTGGGG + Intergenic
972223113 4:36979209-36979231 TTATTTTCAGGAGTGTGTTGAGG + Intergenic
973029745 4:45322516-45322538 CTATTTACATTCTTTTGTTGAGG - Intergenic
973234787 4:47888312-47888334 CTAACTGCATGTTTGTGTTGTGG - Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976098987 4:81540144-81540166 TAATTTGCATGATTGTGTTGAGG - Intronic
976134726 4:81923367-81923389 CTGTGTGCATGTGTGTGTTTTGG - Intronic
976548824 4:86370662-86370684 CTACTTGCATGACTGTGTTGAGG - Intronic
977752121 4:100621826-100621848 CTATTTCCATAAGTGTGGTGTGG + Intronic
978458698 4:108925789-108925811 CTAATTGCAAGCGTGAGTGGAGG + Intronic
979747712 4:124238664-124238686 CTATTTGTCCGTGTGTGTTGCGG + Intergenic
984309335 4:178036777-178036799 CTAATTGCAAGTGTATGTTGTGG - Intergenic
984373931 4:178902317-178902339 CTATTTCCTTCTGTGTGTTGGGG - Intergenic
987794535 5:22609054-22609076 TTGTGTGCATGCATGTGTTGAGG + Intronic
988800686 5:34693722-34693744 CTGTTAGCAAGCGTGTGCTGCGG - Intronic
988951402 5:36265362-36265384 CTATATGTGTGCGTGTGTTGGGG - Intronic
989019475 5:36985452-36985474 CTATTGTCATGCCTGTGTTTTGG - Exonic
991449168 5:66733315-66733337 CTCTGTGCATGTGTGTGGTGGGG - Intronic
997626480 5:135334609-135334631 CCGTTTGTAAGCGTGTGTTGTGG - Exonic
997635869 5:135405174-135405196 TTTTTTGCATGGGTGTGTGGGGG + Intergenic
997809768 5:136955916-136955938 CTATTTGCATGATTGAATTGTGG + Intergenic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
1000593501 5:163186757-163186779 CTAGTTACATGAGGGTGTTGGGG + Intergenic
1002640473 5:180628341-180628363 CGATCTGCAAGCGTGTGCTGCGG - Intronic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1004284009 6:14303532-14303554 CTATTTGAATAGGTGTGTAGTGG + Intergenic
1005117901 6:22357992-22358014 CTATTTAAAAGCCTGTGTTGTGG + Intergenic
1006557037 6:34876051-34876073 CTGTTTACATGCATGTGCTGGGG + Exonic
1007596958 6:43057054-43057076 TTTTTTGCATGTGTGTGATGGGG + Intronic
1008403641 6:51094123-51094145 CTACTTCCATACGTGAGTTGGGG + Intergenic
1011797388 6:90971567-90971589 AAATTTGCGTGTGTGTGTTGGGG + Intergenic
1012179442 6:96133174-96133196 CCATTTGTATGCGTGTGTACTGG + Intronic
1012729100 6:102857818-102857840 TTATTTTCATGAGTGTGTTAGGG + Intergenic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1014286758 6:119507634-119507656 CTATTTGCACCTGAGTGTTGGGG - Intergenic
1014432960 6:121390767-121390789 CTGTGTGCAGGCCTGTGTTGGGG - Intergenic
1015594904 6:134857190-134857212 ATTTGTGCATGCATGTGTTGAGG - Intergenic
1018010233 6:159663098-159663120 CTATAAACATGCGTGTGTTTGGG - Intergenic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1023082058 7:36535180-36535202 CTGTGTGCCTGTGTGTGTTGTGG + Intronic
1023663899 7:42499852-42499874 TTGTTTGTATGTGTGTGTTGGGG - Intergenic
1031274160 7:119696855-119696877 GTATTTACCTGCCTGTGTTGTGG + Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035539675 8:423181-423203 CTATTTACATCAGTGTGATGAGG - Intronic
1036462293 8:8963876-8963898 CTATTTGCATGTATTTGTTTAGG + Intergenic
1038078099 8:24100874-24100896 CTCTTTGCAGGTGTGTGTTGGGG + Intergenic
1038144528 8:24882844-24882866 ATATTTGCATGGGCTTGTTGAGG - Intergenic
1038835612 8:31118236-31118258 GTATATGCATGTATGTGTTGCGG + Intronic
1038990441 8:32861429-32861451 CTATTTACTTGTGTGTTTTGTGG - Intergenic
1044914587 8:97098835-97098857 CTATTTGCATGTCTCTGTTTGGG - Intronic
1045128251 8:99119064-99119086 CCATTGGGATGAGTGTGTTGTGG + Intronic
1046363634 8:113195840-113195862 ATATATGCATGTGTGTGTGGGGG - Intronic
1046731819 8:117734152-117734174 TAATTGGCATGCTTGTGTTGAGG - Intergenic
1047866889 8:129034688-129034710 CTCTGTGCAAGCATGTGTTGGGG - Intergenic
1048611755 8:136030647-136030669 CTATTTGCATAAGTGTATTTAGG - Intergenic
1050281222 9:4052096-4052118 ATATTTGCATACCTGTGTTTAGG + Intronic
1052012243 9:23424226-23424248 CTCTTTGCATGGCTGTGTAGGGG + Intergenic
1054742819 9:68825968-68825990 CTATTTGCATGTGATTATTGAGG + Intronic
1057085978 9:92210735-92210757 CTATGTGCATGTATGTGTAGGGG + Exonic
1060072433 9:120562035-120562057 CTTTTGACAAGCGTGTGTTGAGG - Intronic
1060320256 9:122552527-122552549 CTATTTGTATGCGTGTGTGTGGG + Intergenic
1186139034 X:6551349-6551371 ATATTTGTGTGAGTGTGTTGAGG + Intergenic
1187250169 X:17590816-17590838 TTCTTTGTATGTGTGTGTTGGGG - Intronic
1187955067 X:24509485-24509507 GTATGTGTATGTGTGTGTTGGGG - Intronic
1194955112 X:100169576-100169598 CTATTTTAATGGGTGTGTAGTGG - Intergenic
1196034572 X:111130207-111130229 CTGTTTGCATGTGTGAGTGGGGG + Intronic
1196163711 X:112514624-112514646 CTATTTGCTGGTGTGTCTTGTGG - Intergenic
1196594847 X:117533311-117533333 TTATTTATATGTGTGTGTTGCGG + Intergenic
1196611781 X:117723434-117723456 CCATGTGCATGTGTGTATTGTGG + Intergenic
1198347886 X:135776825-135776847 ATATATGTATGCGTGTGTGGGGG - Intergenic
1198349791 X:135794087-135794109 ATATATGTATGCGTGTGTGGGGG - Intergenic
1198351695 X:135811363-135811385 ATATATGTATGCGTGTGTGGGGG - Intergenic
1198353605 X:135828625-135828647 ATATATGTATGCGTGTGTGGGGG - Intergenic
1198355511 X:135845881-135845903 ATATATGTATGCGTGTGTGGGGG - Intergenic
1198357421 X:135863166-135863188 ATATATGTATGCGTGTGTGGGGG - Intergenic
1198359334 X:135880445-135880467 ATATATGTATGCGTGTGTGGGGG - Intergenic
1199519051 X:148714390-148714412 ATATTTGCATTCCTATGTTGTGG + Intronic