ID: 1127744427

View in Genome Browser
Species Human (GRCh38)
Location 15:61951994-61952016
Sequence GAAATAGTTGGTGGTAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127744427_1127744430 -5 Left 1127744427 15:61951994-61952016 CCAGTATTACCACCAACTATTTC 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1127744430 15:61952012-61952034 ATTTCACCAATATGCAATGAAGG 0: 1
1: 0
2: 2
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127744427 Original CRISPR GAAATAGTTGGTGGTAATAC TGG (reversed) Intronic
901697797 1:11022229-11022251 GGAAGATTTGGTGGTAATCCAGG + Exonic
908905329 1:69001849-69001871 TAAATAGTTGGTTTTAATATTGG - Intergenic
909050760 1:70765471-70765493 GAAATAGTTGTCGGAAATAGGGG + Intergenic
910426482 1:87124238-87124260 GAAATAGATGGTGGTGATGGTGG - Intronic
914689005 1:150009321-150009343 GAAAGAGGTGGCGGTAAGACTGG - Intronic
915674717 1:157519438-157519460 GAAAGACTTGGTGGTCATAGTGG + Intronic
916242209 1:162651306-162651328 TAAATAGTTGGTGGGAGGACAGG - Intronic
917878739 1:179312316-179312338 GAAATTGGTGGTGGTGATAAGGG + Intronic
923357167 1:233169727-233169749 GAACTAGTTGGTGGTTACAGAGG - Intronic
1068658623 10:59600624-59600646 GACAATGTTGGTGGTAATAGTGG + Intergenic
1070476409 10:76833622-76833644 GAAATAATTGCTGGCAATAATGG - Intergenic
1077831081 11:5871133-5871155 TAAAGAGTTGCTGGTTATACTGG + Intronic
1078279248 11:9883261-9883283 GCAATAGATGGTAGAAATACTGG - Intronic
1083974548 11:66107156-66107178 GAAGTAGTAGGTGGTCAGACTGG - Intronic
1085189772 11:74609083-74609105 CAAATTGTTGGTAATAATACAGG - Intronic
1089533534 11:119147685-119147707 GCAATAGTTGGTGGCAAAGCAGG - Intergenic
1096314331 12:50550960-50550982 CAAATAGCTGGGGGTACTACAGG - Intronic
1099561220 12:84176081-84176103 GAAATAGTATATAGTAATACTGG + Intergenic
1100225572 12:92552538-92552560 GAAATAGATGGTGGTAGTGAGGG - Intergenic
1103424519 12:120820950-120820972 GAAATATTTTGTGATAATGCAGG - Intronic
1106875377 13:34066410-34066432 AAAATAGATGGTGGAAATTCAGG - Intergenic
1109273072 13:60275586-60275608 GGAAGATTTGGTGGTAATCCAGG + Intergenic
1110971582 13:81769596-81769618 AAAATACTTGTGGGTAATACTGG - Intergenic
1112095666 13:96129232-96129254 GAAAATGTTGGTGGTGATATAGG + Intronic
1113280080 13:108779288-108779310 CAAATGATTGGTGGTAATTCTGG - Intronic
1115879405 14:37898379-37898401 AAAGTAGTTTGTGGTAAAACTGG - Intronic
1117167752 14:53056215-53056237 GAAGTAGTAGATGGTAATCCTGG + Intronic
1117902497 14:60550391-60550413 GAGATAGTTTGTGGCAACACTGG + Intergenic
1120918274 14:89729769-89729791 GAAATTGTTGGTGGCATAACTGG - Intergenic
1122916310 14:104860611-104860633 GAGATAGATGGTGGTGATAGAGG - Intergenic
1122916322 14:104860661-104860683 AAAATAGTTGGTGGTGATGGAGG - Intergenic
1126011610 15:44308138-44308160 GAAATAGATGGTAGTAATCATGG - Intronic
1126649165 15:50904447-50904469 GAATTAGTTGGTGCTGACACTGG + Intergenic
1126922849 15:53547146-53547168 TAAATAGTTGTTGGTAACAGTGG - Intronic
1127744427 15:61951994-61952016 GAAATAGTTGGTGGTAATACTGG - Intronic
1135318071 16:21468183-21468205 CAAGTAGTTGGTGGGACTACTGG - Intergenic
1135370965 16:21899978-21900000 CAAGTAGTTGGTGGGACTACTGG - Intergenic
1135440819 16:22470739-22470761 CAAGTAGTTGGTGGGACTACTGG + Intergenic
1136314840 16:29447893-29447915 CAAGTAGTTGGTGGGACTACTGG - Intronic
1136328282 16:29549629-29549651 CAAGTAGTTGGTGGGACTACTGG - Intergenic
1136442967 16:30289652-30289674 CAAGTAGTTGGTGGGACTACTGG - Intergenic
1139889712 16:70242124-70242146 CAAGTAGTTGGTGGGACTACTGG - Intergenic
1141444315 16:84048205-84048227 GAATTAGATAGTGGTGATACTGG - Intergenic
1148494398 17:48044381-48044403 GCAAAAGATTGTGGTAATACGGG - Intergenic
1150893931 17:69187232-69187254 GAAATATATGGTGGAAATTCAGG - Intronic
1151731211 17:75912337-75912359 CAAAGTGTTGGTGGAAATACCGG + Intronic
1155668364 18:28338165-28338187 TAACTAGTATGTGGTAATACAGG + Intergenic
1158387021 18:57006401-57006423 GAAAAATGTTGTGGTAATACAGG - Intronic
1158861373 18:61595196-61595218 GAACTAGATGGTGGTGATAGTGG + Intergenic
1163015998 19:14455038-14455060 CAAATAGCTGGTGGGATTACAGG + Intronic
1165379278 19:35466756-35466778 GAAATACTTGGGGCTAATAACGG - Intergenic
1167389673 19:49186454-49186476 GAAATACTTGGAGGGAATAAGGG - Intronic
925775824 2:7334770-7334792 GAAAAGGTAGGTGATAATACAGG - Intergenic
926635363 2:15173027-15173049 TAAATAGCTGATGTTAATACAGG + Intronic
928588040 2:32782184-32782206 GAAATACTTAGTAGTAACACTGG + Intronic
930582050 2:53223629-53223651 TAAATAGTTTGTGGCAATAATGG + Intergenic
932333139 2:70912066-70912088 GAATTAGTTGGAGGAAAGACAGG - Intronic
933387526 2:81630151-81630173 GAAATATTTGCTGATTATACAGG - Intergenic
933680170 2:85092744-85092766 GAGATAAGTGTTGGTAATACCGG - Intergenic
936587688 2:113772750-113772772 GAAATAGTTGGAGGGAAAATAGG + Intergenic
939053680 2:137335567-137335589 GCAACAGTTGGTGATAATATTGG + Intronic
941913444 2:170789929-170789951 GAAAGAGTGTGTGGTGATACTGG + Intronic
944333371 2:198499692-198499714 GAAACAGCTGGTGATAATTCTGG + Intronic
945733080 2:213565130-213565152 GAACTAGTTGGCGGTAGTGCTGG - Intronic
948477931 2:238232541-238232563 GGAAGATTTGGTGGTAATCCAGG + Intergenic
1169374330 20:5054372-5054394 CAAATAGCTGGTGGGACTACAGG - Intergenic
1170995890 20:21358140-21358162 AAAATAGTCTGTTGTAATACAGG - Intronic
1171031284 20:21678994-21679016 GAAATAGGTGGTGGATATGCAGG - Intergenic
1171324710 20:24281407-24281429 GAAGTAGTTGATGGAAATGCGGG - Intergenic
1172422556 20:34829638-34829660 GATCTAGGTGGTGGTAACACAGG - Intergenic
1174921096 20:54702890-54702912 GAACTAGTTGCTGAAAATACAGG - Intergenic
1177639044 21:23822420-23822442 GAAATTGTAGGTGGTAAGATTGG - Intergenic
1178790157 21:35692660-35692682 GAAAGAGATGTTGGAAATACAGG + Intronic
1180951233 22:19721526-19721548 GAGATAGTTGATGGTGATGCTGG + Intronic
949767244 3:7540382-7540404 GAAATACTTGATGGTAAAAAAGG + Intronic
952369641 3:32709198-32709220 GAAATTTTTGGTGGTAATTATGG + Intronic
953249912 3:41235742-41235764 GAAATAGTTGAAGGTTGTACCGG + Exonic
953842423 3:46399848-46399870 GAAATAGTTGATGGAAAAATTGG + Intergenic
956415049 3:69016819-69016841 CAAATTGTTGGTGGCAATATTGG + Intergenic
957381830 3:79440830-79440852 AAAATTGTTGGTGGAAATAAGGG + Intronic
957682668 3:83457733-83457755 GAAATAGTTGCTAGGAAAACTGG + Intergenic
958685257 3:97385579-97385601 GAAATATTTGGAGGCATTACAGG - Intronic
958902237 3:99901032-99901054 GGAATACTGGGTGGAAATACTGG + Intronic
959140094 3:102475289-102475311 GGAAGTGTTGGTGGTAATACGGG + Intronic
959747323 3:109791719-109791741 GAAGTAGTTAGAGGTAATAAAGG - Intergenic
960801005 3:121540356-121540378 GACATAGTTAGTGGCAAAACTGG + Intronic
965259102 3:166457169-166457191 GAAATAGTTGTAGGTACTGCTGG - Intergenic
966829721 3:183996943-183996965 GAAATATCTGATGGAAATACAGG + Intronic
970341452 4:15111492-15111514 GAAAGAGCTGGTGGTTATGCTGG - Intergenic
970781745 4:19745864-19745886 GACGTAGTTGGTGATAAGACAGG - Intergenic
972299301 4:37770173-37770195 GAAATGCATTGTGGTAATACAGG - Intergenic
975920861 4:79385407-79385429 GAAAGTCTTAGTGGTAATACAGG + Intergenic
975939843 4:79629387-79629409 GAAATATTAGGTGGAAATAGTGG + Intergenic
980257840 4:130404207-130404229 GAAAGATGTGGTGGTAATCCGGG + Intergenic
980673252 4:136038467-136038489 GAAATAAGTGGTGGTAAATCAGG + Intergenic
982826211 4:160006901-160006923 TAAATAGGTGTTGGTAAAACTGG + Intergenic
983216303 4:165006280-165006302 GAAAGAGTGGGTGGAAATAAGGG + Intergenic
985183211 4:187288113-187288135 CTATTAGTTAGTGGTAATACTGG - Intergenic
988330688 5:29836112-29836134 GAGATATTTGGTGGTAAACCAGG + Intergenic
988916810 5:35902784-35902806 AAACTAGTTTCTGGTAATACGGG + Intergenic
993092592 5:83444654-83444676 GAGATAGATGGTGGTAATGATGG - Intergenic
993346575 5:86791142-86791164 GAAATGGTTGGTTTTAAGACTGG - Intergenic
995000630 5:107123393-107123415 AAAATAGTTGTTGGAAACACTGG - Intergenic
998742612 5:145222103-145222125 GAATTAGATGGTGGTAGTATGGG + Intergenic
1000015783 5:157274245-157274267 GAAATAGGTGGTGGTGCTAAAGG - Intronic
1000541328 5:162543646-162543668 GAAATAATTTATGGTAATACAGG + Intergenic
1000724340 5:164750956-164750978 TAAATATTTGGTGCTCATACTGG - Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1003682020 6:8266009-8266031 GAGAGAGTTGTTGGTAATAGAGG + Intergenic
1005890831 6:30136479-30136501 GTAATTATTGGTGGTAATAATGG + Intronic
1008647583 6:53530833-53530855 GAAAGGGATGGTGGTAATGCAGG - Intronic
1008656078 6:53615251-53615273 GAATTAGATGGTGGTAACATAGG + Intronic
1008772020 6:54990770-54990792 GAAATAATTAATGATAATACAGG - Intergenic
1010253616 6:73733625-73733647 GAAGTTGTTGGTGCTAGTACGGG + Intronic
1011507574 6:88063873-88063895 TATTTAGATGGTGGTAATACAGG + Intronic
1012330556 6:97979711-97979733 GAAATAGATGGTGAAAATATTGG + Intergenic
1012681327 6:102185242-102185264 GAGAAAGTTGCTGGTAAAACTGG - Intergenic
1012704299 6:102501695-102501717 GAGATGGGTGGTGGTGATACTGG - Intergenic
1015211090 6:130699848-130699870 GAAAAAGTTAGAGGTAAGACTGG - Intergenic
1018543066 6:164904612-164904634 GAAATAATTGAGGTTAATACGGG + Intergenic
1019724068 7:2591285-2591307 GAAATAGTTGGTGTGACCACAGG + Intronic
1019881287 7:3863501-3863523 GAAATGGATGGTGGTAATGGTGG - Intronic
1021985530 7:26094725-26094747 GCAAAAGTTGGTGGTGATATGGG - Intergenic
1023315632 7:38933201-38933223 GAAACTGTCGGTGGGAATACAGG - Intergenic
1024447436 7:49497733-49497755 GTAATGGGTCGTGGTAATACAGG + Intergenic
1025940076 7:66069689-66069711 GATATTGTAGGTGCTAATACTGG - Intergenic
1026473396 7:70713271-70713293 AAAATAGTTAGTGGTAATCACGG - Intronic
1029289124 7:99488532-99488554 GTAATAGTTGTATGTAATACAGG - Intronic
1030648474 7:112091182-112091204 GAATTAGTTGGTAGGAACACTGG - Intronic
1032905077 7:136355386-136355408 CAAAAAGCTGTTGGTAATACTGG + Intergenic
1035035410 7:155891266-155891288 GAAGAAGATGGTGGTAGTACTGG + Intergenic
1037087304 8:14868365-14868387 GAAATAGATGGTGGCTGTACTGG - Intronic
1037555636 8:20019401-20019423 TGAATAGGTGGTGGTACTACTGG + Intergenic
1041915718 8:63136808-63136830 GGAAGATTTGGTGGTAATCCAGG - Intergenic
1043238072 8:77894312-77894334 GAAAATGTTGTAGGTAATACTGG + Intergenic
1043998712 8:86851589-86851611 GCAATGATTGGTGCTAATACAGG + Intergenic
1045216696 8:100156363-100156385 GTAATAGTTAGTGGTAATGGTGG + Intergenic
1045227496 8:100263842-100263864 GAAAGAGGTGGGGGTAATTCTGG - Intronic
1046035406 8:108834444-108834466 CAAAAAGTTGGAGGTAATTCTGG - Intergenic
1047518071 8:125572442-125572464 GAAAGTGTTGGTGGCAATATTGG + Intergenic
1048062352 8:130933443-130933465 GAAATATTTGGCAGTAAGACTGG + Intronic
1048685955 8:136905924-136905946 GAAAGTCTTGGTGTTAATACTGG - Intergenic
1050656181 9:7831248-7831270 GAAATGGATGGTGGTTACACAGG - Intronic
1050728466 9:8679078-8679100 GAAATGGAAGGTGGTAGTACAGG + Intronic
1051939088 9:22482971-22482993 TAAATTGTTTGAGGTAATACAGG + Intergenic
1052235330 9:26206497-26206519 AAAACAGTTGGTGGTATTATGGG - Intergenic
1056979925 9:91300258-91300280 GAAATCATTGGTGGTAGTATAGG - Intronic
1185953924 X:4468162-4468184 GAAACAGCTGGTGAAAATACAGG + Intergenic
1188210138 X:27413773-27413795 GAAATAGTTGGAGCTAATAAGGG - Intergenic
1193801609 X:85943569-85943591 GAAAAAGTTGGAGAGAATACGGG - Intronic
1199592829 X:149483728-149483750 GAGATAGATGGTGGTAATGATGG - Intronic
1201741588 Y:17329843-17329865 GAAATAGGTGGTGAAAATACAGG + Intergenic