ID: 1127745567

View in Genome Browser
Species Human (GRCh38)
Location 15:61967829-61967851
Sequence CTGTTGTTTTTAAGTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 514}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127745567_1127745570 7 Left 1127745567 15:61967829-61967851 CCTTTTTAACTTAAAAACAACAG 0: 1
1: 0
2: 3
3: 48
4: 514
Right 1127745570 15:61967859-61967881 CAGATGTCCTTTATATCCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 165
1127745567_1127745572 21 Left 1127745567 15:61967829-61967851 CCTTTTTAACTTAAAAACAACAG 0: 1
1: 0
2: 3
3: 48
4: 514
Right 1127745572 15:61967873-61967895 ATCCTGAGGTAGATGTACCAAGG 0: 1
1: 0
2: 1
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127745567 Original CRISPR CTGTTGTTTTTAAGTTAAAA AGG (reversed) Intronic
901279546 1:8023223-8023245 CTATTGTTTCCAAGTTGAAAAGG + Intronic
903698599 1:25229230-25229252 CTATTGCTTTTAGGATAAAATGG - Intronic
903729996 1:25486187-25486209 CTGAAGTTTTTATCTTAAAATGG + Intronic
904510797 1:31005535-31005557 CTTTTATTTTAAAGTAAAAATGG + Intronic
905012049 1:34754461-34754483 ATGTTGTCTTTGGGTTAAAAAGG - Intronic
905663146 1:39743978-39744000 CTTTTTTTTTTAAGTTTTAATGG + Intronic
906308051 1:44733584-44733606 TTGTTGTTTTTCTGTTAAAAGGG - Intergenic
906885222 1:49638062-49638084 CTGTTGTTCTTAGTTTAAATTGG + Intronic
906940908 1:50254500-50254522 CTGTTGTGTTGCAGGTAAAAAGG + Intergenic
908032151 1:60012709-60012731 CTGAGTTTTTCAAGTTAAAATGG + Intronic
908304317 1:62795823-62795845 TTTTTTTTTTTAAGTAAAAAGGG - Intronic
908504607 1:64783999-64784021 CTGTTCTCATTAAGTTAACAGGG + Intronic
908948769 1:69533508-69533530 CTGTTGTTTTGTTGTTAAACAGG - Intergenic
909401516 1:75237125-75237147 ATGTTCTTTTTATGATAAAAGGG + Intronic
909604561 1:77495505-77495527 TTCCTGTTTTGAAGTTAAAATGG - Intronic
909822785 1:80087061-80087083 TTGTGATTTTTAAGTTAACATGG + Intergenic
910045968 1:82916971-82916993 CTGTCATTTTTAACTTAAACTGG - Intergenic
910316586 1:85891429-85891451 TTTTAGTTTTTAAGGTAAAATGG - Intronic
910409121 1:86922089-86922111 CTGTTGTCTTTAGGATTAAAGGG + Intronic
910449804 1:87333686-87333708 CTTTTATTTTTAAATTAAGATGG + Intronic
910883942 1:91946774-91946796 CTTTTTTTTTTAACTTGAAATGG - Intergenic
910922696 1:92366373-92366395 ATGTTGTTTTTCAGTAAATATGG - Intronic
911565538 1:99459124-99459146 TTAATGTTTTTAAGTAAAAATGG + Intergenic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
911834118 1:102594220-102594242 CTATTGTTTATAAGTTACCAAGG + Intergenic
912540858 1:110414142-110414164 TTGTTGTTTTTAACTGTAAAAGG - Intergenic
914986059 1:152458041-152458063 TTGTTGTTTTGTAGGTAAAATGG + Intergenic
915109003 1:153551121-153551143 TTGTTGTTTTTAAGCTGAAGTGG + Intergenic
916701109 1:167295924-167295946 CTGCTGTTTTTAATTCAGAAAGG + Intronic
916971003 1:170016038-170016060 TTTTTGTTACTAAGTTAAAAAGG - Intronic
917005048 1:170405754-170405776 CTGTTGTTTTTAAATTACCCAGG + Intergenic
917104316 1:171477180-171477202 CTGTTGTTCATAAAGTAAAAGGG - Intergenic
918302807 1:183219357-183219379 CTTTTATTTTGAAATTAAAAAGG - Intronic
918488583 1:185055423-185055445 TTGTTGTTTTTAAATTTAAATGG + Intronic
918504663 1:185239037-185239059 CTACTATTTTTAAGATAAAAGGG - Intronic
918692834 1:187503492-187503514 GTGTTATTCTTAAGTTAAACAGG - Intergenic
918934919 1:190910118-190910140 CTATTGATTTTCAGTTCAAAAGG - Intergenic
920046916 1:203139123-203139145 GTGTTGTTTTTAAGATAGAAGGG + Intronic
920204385 1:204281173-204281195 CTGTTGTTTTTTAGTGACGAGGG - Intronic
920445577 1:206013686-206013708 CAGTGGTTTTTCAGTTAAATCGG + Intronic
920860069 1:209698733-209698755 CTGTTGTTTTTATGTTTTAAGGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921556534 1:216604831-216604853 TTTGTGGTTTTAAGTTAAAAAGG - Intronic
922061079 1:222092309-222092331 ATGTAGGTTTTAAGTTAAATGGG + Intergenic
922249901 1:223839035-223839057 CTGTAGTTTTAAAGTAGAAAAGG - Intronic
923323457 1:232859185-232859207 TTTTTTTTTTTCAGTTAAAAAGG - Intergenic
923505386 1:234600724-234600746 CTGTGGTTTGTAAGATAAACTGG + Intergenic
923582280 1:235229188-235229210 CTGTTATTTATAATTTTAAAAGG + Intronic
924057904 1:240142108-240142130 CTGTAGCTTTGAAGTTACAAGGG + Intronic
1063247075 10:4232272-4232294 CTTTTGTTTTAAAGTGAGAAAGG - Intergenic
1064061805 10:12144153-12144175 TTGATGTTTTTAGGTTATAAAGG + Intronic
1064503810 10:16007814-16007836 ATGTTATTTTCAACTTAAAATGG + Intergenic
1064819597 10:19311424-19311446 ATTTTGTATTTAATTTAAAAGGG - Intronic
1065051037 10:21792189-21792211 CATTTGTTTTTAAGTTATTACGG - Intronic
1065744767 10:28830379-28830401 GTGTTGTTTTTAACCTAACAAGG + Intergenic
1066028573 10:31392458-31392480 CTGTTGGTTTTCAGTGATAAGGG + Intronic
1066337934 10:34499143-34499165 CTTTTTTTTTTAAGTTGATAAGG + Intronic
1068524763 10:58115949-58115971 CTGTTGTTTATAAGCTAACGAGG - Intergenic
1068572605 10:58646931-58646953 TTTCTGTTTTTAAGTAAAAATGG + Intronic
1068782605 10:60937722-60937744 CTGTTGTGTTCAAGAAAAAAAGG + Intronic
1068959023 10:62847959-62847981 CAGATGTGGTTAAGTTAAAATGG + Intronic
1069034577 10:63633167-63633189 TTGTTTTTTTTAAGTAGAAATGG + Intergenic
1069220478 10:65877143-65877165 CTGTTGTTTTATAGCTCAAAAGG + Intergenic
1069471156 10:68690857-68690879 CTGAACTTTTTAAGATAAAATGG - Exonic
1069891433 10:71654895-71654917 CTGTTGGTTTTAAGTCACCAGGG + Intronic
1070345831 10:75540970-75540992 TTGTTGTTTTTTTTTTAAAAAGG + Intronic
1071073085 10:81717457-81717479 CTGTTGTTGGGAATTTAAAATGG + Intergenic
1071928926 10:90443455-90443477 GTTTTGTTTATAAGTTCAAAAGG - Intergenic
1072445524 10:95495592-95495614 CTGTTGTTTTAAAATTTTAAGGG + Intronic
1072823408 10:98581365-98581387 AAGTTGTTGTTAAGTTAAAATGG - Intronic
1073113521 10:101077247-101077269 CTGGTATTTTTAAGTGAAAAAGG - Intergenic
1073445550 10:103578246-103578268 CTTTTGTCTTTAGGTTAAAAAGG + Intronic
1074272555 10:111969283-111969305 CTGTTTTTTTTAAGTTTTTATGG - Intergenic
1074962139 10:118456275-118456297 CTGGAGTTTTGAAATTAAAAAGG + Intergenic
1075098800 10:119491238-119491260 CTGTTGTTTTTGAGTTACCCAGG + Intergenic
1075474641 10:122723748-122723770 CTGTTGTTGTTATTTTGAAAAGG - Intergenic
1075756903 10:124819767-124819789 CTTTTTTTTTTAAGTTGAGATGG - Intronic
1076924141 10:133473270-133473292 CTGTAATTTTTAAGAAAAAAAGG - Intergenic
1079639113 11:22782004-22782026 ATGTTTTTTATTAGTTAAAATGG + Intronic
1080085024 11:28269611-28269633 CTTTTGTTATTATTTTAAAAGGG + Intronic
1080222872 11:29926734-29926756 ATGTTCTTTTTAAGTTCAAATGG - Intergenic
1080476955 11:32604403-32604425 GTGTTGTGTTTTAGTTGAAAGGG + Exonic
1080984052 11:37440497-37440519 CTTTTTTTTTTAATTAAAAATGG + Intergenic
1081324904 11:41732317-41732339 CTTGTGTTTTGCAGTTAAAAAGG - Intergenic
1081498359 11:43639165-43639187 TCATTGTTTTTAATTTAAAAAGG + Intronic
1081801375 11:45861765-45861787 CTGTGGTTTTCAGGTGAAAAAGG - Intronic
1082172629 11:49024569-49024591 CTGTTGTTTATAAACAAAAATGG + Intergenic
1082983266 11:59143443-59143465 CTGTTCTTTTTAAGTTTCCAGGG - Intronic
1083466773 11:62852428-62852450 CTTTTGTTTTTTAGATACAAGGG - Intergenic
1084903983 11:72331896-72331918 CTGTTGTTCATAAGTTGATAGGG - Intronic
1085160078 11:74332938-74332960 CTGTTATTTTTAATTTAACCTGG - Exonic
1085850716 11:80116485-80116507 ATTTTTTTTTTAAGGTAAAATGG - Intergenic
1086703161 11:89922810-89922832 CTGTTGTTTAAAAATTAAGAAGG + Intergenic
1087376776 11:97352363-97352385 ATGTTGTTTTTAAGTTATTTTGG + Intergenic
1087388202 11:97500686-97500708 TAGTTGTTTTTTAGTAAAAATGG + Intergenic
1087440050 11:98171983-98172005 CTATTATTTTTATTTTAAAATGG - Intergenic
1087684406 11:101246836-101246858 CTGTTTTTTTTAAAAAAAAAAGG + Intergenic
1087708646 11:101523960-101523982 CTGTGGTTTTAAAATTATAATGG + Intronic
1087770142 11:102200341-102200363 CTATAGTTTTTTAATTAAAATGG + Intronic
1088065900 11:105719040-105719062 TTGTTTTTTTTAAATTTAAAAGG + Intronic
1088286009 11:108188818-108188840 CTGTTGTATTTGATTTTAAATGG - Intronic
1090163506 11:124520537-124520559 CTGGTGTTGTAATGTTAAAATGG + Intergenic
1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG + Intergenic
1090581132 11:128160176-128160198 CTGTTGTCTTTAAGTTATTATGG + Intergenic
1091089333 11:132755101-132755123 CTACTGTTTTTAGGTCAAAATGG + Intronic
1091198568 11:133752862-133752884 TTGTTGTTTTTAACTAAAGAAGG - Intergenic
1091420087 12:330285-330307 CTAATGTTTATAAGTTACAATGG - Intronic
1092603666 12:10095528-10095550 CTTTTTTTTTGAAGATAAAATGG - Intronic
1092973208 12:13718781-13718803 CTTTTGTGTTTTAGTTTAAAAGG + Intronic
1093152566 12:15640171-15640193 CTCTTGATTTTAAGATTAAAAGG - Intronic
1093515598 12:19982889-19982911 CTGTTGTTTGTAAGTTACCCAGG + Intergenic
1093631561 12:21416164-21416186 CTGTTATTTTTTAATTCAAATGG + Intronic
1093641667 12:21534200-21534222 CTGATATTTTTAATTTATAATGG - Intronic
1093728236 12:22540555-22540577 CTGTTGTTATTATTTTAATATGG - Intronic
1093980504 12:25470416-25470438 CTGTTTTTCTTGACTTAAAATGG + Intronic
1094247491 12:28316670-28316692 CTGTTGTTTTTACATGAAATTGG + Intronic
1095316985 12:40776135-40776157 CTATTCTTTTTTATTTAAAATGG + Intronic
1096294473 12:50372118-50372140 ATTTTTTTTTTAATTTAAAAAGG + Intronic
1097084874 12:56460080-56460102 TTGTTGTTTTTTTGTTAAAAAGG - Intronic
1098550643 12:71757413-71757435 GTGTAATTTTTAAGTTGAAAGGG - Intronic
1098680754 12:73350459-73350481 CTGGTTTTTGAAAGTTAAAAAGG + Intergenic
1098759968 12:74411080-74411102 CTGTTATATTAAAGTTAAAAGGG + Intergenic
1098861125 12:75711443-75711465 CTGTTGTTTTAATGTGAAAAGGG + Intergenic
1099103996 12:78478246-78478268 CCCTTGTTTTTAAGGGAAAAAGG - Intergenic
1099553980 12:84086099-84086121 CTTTTGTTTTTCAGTAAAATAGG + Intergenic
1100654064 12:96621453-96621475 CGGTTTTTTTTAAAATAAAAGGG + Intronic
1100766541 12:97872401-97872423 CTGTGGTTTTAAAGTAAGAAGGG + Intergenic
1100977573 12:100138303-100138325 CTGATCTATTTAAGTAAAAAGGG - Intronic
1101665764 12:106812472-106812494 CTGTTGTTTTTGGTTTAGAATGG + Intronic
1102105392 12:110317235-110317257 CTGTTGTTTTTGAATCTAAATGG - Intronic
1102324647 12:111969580-111969602 CTGTTGTTTTTTTTTTGAAATGG + Intronic
1102968219 12:117145447-117145469 CTTTTTTTTTTAAATTTAAATGG - Exonic
1103772822 12:123341696-123341718 ATTTTTTTTTTAAGTAAAAACGG + Intronic
1103829989 12:123771296-123771318 CTGAGGTTTTTTACTTAAAAGGG - Intronic
1103945358 12:124523163-124523185 ATGTTGTTTTTATTTTTAAAAGG + Intronic
1104541115 12:129665505-129665527 CTTTTTTTTTTCAGTCAAAAAGG + Intronic
1107349154 13:39496153-39496175 CTGTTGTTTATAAGTTACTCGGG - Intronic
1107504021 13:41012427-41012449 GTTTTGTTTTTAAGAAAAAAAGG + Intronic
1107670394 13:42740557-42740579 CTGTTGTTTTTTATTTTAAAGGG + Intergenic
1107862396 13:44673307-44673329 TTGTTCTTTTAAGGTTAAAAGGG + Intergenic
1108301970 13:49086806-49086828 CTGATGTTTTCATATTAAAAGGG - Intronic
1109077426 13:57854434-57854456 CTGTGTTTTACAAGTTAAAATGG + Intergenic
1109094836 13:58100534-58100556 CTATTGTTTACATGTTAAAATGG - Intergenic
1109575239 13:64248051-64248073 CTTGTGTTTTTAAGTTAAATGGG + Intergenic
1110050490 13:70891148-70891170 CTGTTGTTTTTAGAATGAAAAGG - Intergenic
1110118938 13:71857312-71857334 CTGTTGTATTTCAGTAAAATAGG + Intronic
1110316146 13:74109843-74109865 ATGTTGCTTTTTAGTAAAAACGG - Intronic
1110722592 13:78781165-78781187 CTTTAGTTTTAGAGTTAAAATGG + Intergenic
1110894727 13:80735081-80735103 AAGTTGTTTTAAAGTTTAAAGGG - Intergenic
1110971549 13:81768999-81769021 GAGTTGTTTGGAAGTTAAAAAGG + Intergenic
1111369816 13:87302336-87302358 AAGTTATTTTTAATTTAAAAAGG + Intergenic
1111656105 13:91155676-91155698 CTTTAGCTTTTAAGTTCAAAGGG - Intergenic
1111711314 13:91817909-91817931 TAGTTGTTTTTAAGAAAAAAAGG - Intronic
1112435339 13:99387944-99387966 CAATTGTTCTTAAGTTGAAATGG + Intergenic
1112490770 13:99861282-99861304 CTTTTGTTTTTAAGCCAATAGGG - Intronic
1112718605 13:102215788-102215810 CTTTTATTTTTGAGTGAAAAAGG + Intronic
1112945035 13:104918185-104918207 CTCTTGTTTTTAAATGAATATGG - Intergenic
1113110679 13:106819895-106819917 CTGGTGTTGTTAAGATGAAACGG + Intergenic
1113141132 13:107150672-107150694 TTGTTGTTGTTGAGTTAAAAGGG + Intergenic
1114837639 14:26222428-26222450 GTGTTGTTTTCAAGTAGAAATGG - Intergenic
1115306682 14:31940768-31940790 CTATTTTTTTTAATTTAAATAGG - Intergenic
1115803434 14:37022894-37022916 CTATTGTTTTTATACTAAAAGGG - Intronic
1115809158 14:37086795-37086817 CCATTGTTTTTGAGTTGAAAGGG + Intronic
1116169238 14:41378037-41378059 CTCTTCTTTTCAAGTTCAAAAGG + Intergenic
1116501015 14:45622014-45622036 CTGATTTTTAAAAGTTAAAAGGG + Intergenic
1116776690 14:49189425-49189447 CTTTTGTTTTGAAGTCAACAAGG - Intergenic
1116837697 14:49787282-49787304 CTGTTGTTTCTAAATTATACAGG - Intronic
1117271059 14:54143891-54143913 CTATTGGCTTTAAGTAAAAATGG + Intergenic
1117958336 14:61139822-61139844 CTATTGTTTTTATTTTACAAAGG - Intergenic
1118409198 14:65459472-65459494 CAGTTAATTTTAAGTTAAACAGG - Intronic
1118537148 14:66780131-66780153 GTGTTGCTGTTAACTTAAAAAGG + Intronic
1119346695 14:73930903-73930925 ATTTTGTTTTTATATTAAAATGG + Intronic
1119445554 14:74660540-74660562 GTTTTGTTTTTAAATTCAAAAGG + Intronic
1119505008 14:75164992-75165014 ATGTGGTTTTTAACTTAATAAGG + Intronic
1119548235 14:75489110-75489132 CTTTTTTTTTTAAGTTTAAAAGG - Intergenic
1119812266 14:77532043-77532065 TTGTTGTTTTTAAGTAAAAGGGG - Intronic
1120342017 14:83233168-83233190 CTGTAAATTTTAAGTTAAAAAGG + Intergenic
1120529427 14:85614364-85614386 CTTTTTTTTTTAATTTCAAAGGG - Intronic
1120712593 14:87808200-87808222 CTGTTGTTTTTAGTTTAATTTGG - Intergenic
1123879185 15:24658848-24658870 CTGTTCTTTTTAAGTTGTTAGGG + Intergenic
1124073422 15:26418147-26418169 CTGTTGTTTTTAATGTATTAAGG - Intergenic
1124158847 15:27251547-27251569 CTGTAGATTTCAAGTCAAAATGG - Intronic
1124588181 15:31029880-31029902 CTTTTTTTTTTAAATTAAATTGG - Intronic
1125934276 15:43621072-43621094 TTGTTGTTTTTACTGTAAAAAGG + Intergenic
1125947379 15:43720538-43720560 TTGTTGTTTTTACTGTAAAAAGG + Intergenic
1126146214 15:45475174-45475196 TTTTTTTTTTTAAGTTAAACAGG - Intergenic
1126152638 15:45536852-45536874 GTGTAATTTTTAAGTGAAAATGG + Intergenic
1126209774 15:46088099-46088121 CTGTTATTTTTCTGTAAAAATGG + Intergenic
1126300365 15:47188091-47188113 CTGTTCTATTTATGTAAAAATGG + Intronic
1126431776 15:48593438-48593460 CTGTCATTTTTCAGTTAACAGGG - Intronic
1126929843 15:53635239-53635261 TTGTCTTTTTTCAGTTAAAATGG - Intronic
1127176013 15:56358427-56358449 TTTTTTTTTTTAAGTTAAAAGGG - Intronic
1127596921 15:60494089-60494111 ATGTTTTTCTTAAGTTAGAAAGG + Intronic
1127745567 15:61967829-61967851 CTGTTGTTTTTAAGTTAAAAAGG - Intronic
1127889203 15:63233813-63233835 CTGTGCTTTTACAGTTAAAAAGG - Intronic
1128117319 15:65117992-65118014 CTGTTATTTTTAAGTTTCTAAGG - Exonic
1128167594 15:65480117-65480139 CATTTTTTTTTAAGTTTAAAGGG - Intronic
1128292929 15:66492297-66492319 GTTTTGTTTTTAATCTAAAAAGG - Exonic
1128950625 15:71876892-71876914 CGTTTGTTTTTAAGTTTAAAAGG - Intronic
1129764296 15:78151624-78151646 TACATGTTTTTAAGTTAAAAAGG + Intronic
1130397000 15:83511497-83511519 CTGCTGTTTTCATTTTAAAAAGG - Intronic
1130774002 15:86958027-86958049 TTTTTATTTTTAAGTTACAAGGG - Intronic
1130804736 15:87307900-87307922 CTGTTTATTTTAAGTGAAAGGGG + Intergenic
1130929965 15:88417709-88417731 CTTATTTTTTTAACTTAAAATGG + Intergenic
1132123913 15:99203174-99203196 CTGTTTTTTTAAAGTTCAATTGG - Intronic
1133454288 16:5929705-5929727 CTGTTTTTTTTATGTTAAAATGG + Intergenic
1134355038 16:13474452-13474474 CTGTAGTTTTGAAGATTAAACGG - Intergenic
1135651922 16:24213854-24213876 CTGGTGTTTCTATATTAAAAAGG - Intronic
1135666415 16:24339141-24339163 CTATTCTTTTTAATTTAAAAGGG + Intronic
1137487495 16:48903698-48903720 CTGCTGTTTTTAAATTCAAATGG - Intergenic
1138915553 16:61459443-61459465 TTGTGTATTTTAAGTTAAAAAGG + Intergenic
1139793918 16:69466281-69466303 TTATTATTTTTAATTTAAAAAGG + Intergenic
1140762326 16:78121245-78121267 CAAATGTTTTTAATTTAAAATGG - Intronic
1143716716 17:8777053-8777075 TTGTTGTTTTTAAGGGATAATGG + Intergenic
1148821183 17:50360580-50360602 TTTTTTTTTTTAATTTAAAAAGG + Exonic
1148824026 17:50378909-50378931 CTGGTGATTTCATGTTAAAAGGG + Intronic
1150169890 17:62982346-62982368 TTTTTGTTTTTAAGTATAAAGGG - Intergenic
1151254015 17:72861092-72861114 CTTTTGGATTTAAGTTAAAATGG - Intronic
1151928680 17:77216669-77216691 CTGTTCTTTTTAAGTTGATTCGG + Exonic
1152243341 17:79171828-79171850 CTGTAATATTTAATTTAAAAAGG + Intronic
1153594299 18:6708949-6708971 CTCTTGTTTTTCAATAAAAAAGG - Intergenic
1155863180 18:30930407-30930429 TTGTTGTTTTTATACTAAAATGG - Intergenic
1155986982 18:32240072-32240094 CTGCTGTTTTTAAGACCAAATGG - Intronic
1156749873 18:40439258-40439280 GAGATGTTATTAAGTTAAAAAGG + Intergenic
1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG + Exonic
1157251069 18:46096657-46096679 TTGTTGTTTTTAAGTAAAATTGG - Intronic
1158103688 18:53860607-53860629 GTGTTGGTTATAAGTTCAAAGGG - Intergenic
1158175240 18:54648988-54649010 CTGTTGGTTTGAAATTTAAATGG + Intergenic
1158461186 18:57647625-57647647 ATGTTGTATTTCAGTTCAAATGG - Exonic
1158593163 18:58794342-58794364 TGTTTGTTTTTAAGTTAAAGGGG + Intergenic
1158888401 18:61850379-61850401 ATGTGGTTTTTAAGTGAAATAGG + Intronic
1159025365 18:63178305-63178327 CTGTTGTTTAGAAATGAAAATGG + Intronic
1159109441 18:64040119-64040141 CTTTGTTTTTTAACTTAAAATGG - Intergenic
1159774452 18:72586687-72586709 CTGGTGTTATTAGGTGAAAATGG + Intronic
1162240192 19:9345908-9345930 GTATTGTTTTTAATTTACAATGG + Intronic
1163138224 19:15329083-15329105 TTTTTTTTTTTAAGTTAACAAGG + Intronic
1163553188 19:17977284-17977306 CTGGTGTTCTTATTTTAAAAAGG - Intronic
1164668199 19:30056369-30056391 TAGTTGTTTTTAACTTTAAAAGG + Intergenic
1166034912 19:40161086-40161108 GTATTGTTTTAAGGTTAAAAAGG + Intergenic
1168594896 19:57667454-57667476 CTGTTATTTTGATGTTAAAATGG + Intergenic
925301752 2:2820352-2820374 CTGTTTTTTTTAATTGAAACAGG - Intergenic
925579219 2:5393454-5393476 CTGTTTTTTTGATATTAAAAAGG - Intergenic
925828198 2:7871244-7871266 CAGGTGTAATTAAGTTAAAATGG + Intergenic
926175853 2:10591555-10591577 CTGTTATTTTGAAGATATAAGGG + Intronic
926290424 2:11524924-11524946 CTGTTGTTTTTCTGGTAAAGCGG + Intergenic
926582382 2:14645016-14645038 ATATTGTGTTTAATTTAAAATGG + Intronic
927658637 2:24972548-24972570 CTATTGTTTTTTATTTTAAATGG + Intergenic
928564524 2:32530802-32530824 CTTTTGTTTTAATGTTTAAAGGG + Intronic
929324881 2:40597376-40597398 ATGTTGTTGTTAAATGAAAAAGG + Intronic
929329249 2:40659953-40659975 ATCATCTTTTTAAGTTAAAAAGG - Intergenic
929334824 2:40729250-40729272 CTTATGGTTTTAAATTAAAAAGG - Intergenic
929433621 2:41909648-41909670 CTGTTGTTTTTCACTTCAAGTGG - Intergenic
929869671 2:45748022-45748044 CTGTTGTTATTAAGTTATAGGGG + Intronic
930289887 2:49480848-49480870 ATGTTTTTTATAAGTTCAAAGGG - Intergenic
930472440 2:51835982-51836004 CTGTTGTTTTAGATTTCAAAAGG + Intergenic
930982983 2:57550549-57550571 CTCTGGTTCTTAAGTTAGAAGGG - Intergenic
931157246 2:59649111-59649133 TTGTTTTTTTTAGGTTATAAAGG - Intergenic
932234327 2:70108963-70108985 CTTTTGTTTTTCAGTTGAATCGG - Intergenic
932375739 2:71234294-71234316 CTGTTGTTTTGAAAATTAAATGG - Intergenic
932518349 2:72378621-72378643 GTGCTATTTTTAATTTAAAAAGG - Intronic
934862794 2:97778590-97778612 GTGATGATTTTAAGATAAAAAGG - Intronic
934869525 2:97849893-97849915 TTGTTGTTTTAAAGTTAATTTGG - Intronic
935229494 2:101083504-101083526 CTATTATTTTTAACTTAACATGG - Intronic
935348756 2:102135142-102135164 CTGTTTTTTTTAAAATCAAAAGG + Intronic
935501412 2:103844400-103844422 CTTTTGTGTTTATCTTAAAATGG + Intergenic
937642894 2:124233894-124233916 CTGGTGTTTTTGAGTTTAAAAGG - Intronic
937732058 2:125244959-125244981 CTGTTGATTTTTTTTTAAAAGGG - Intergenic
937763476 2:125632639-125632661 CTGTGGTTTAGAAGTAAAAATGG + Intergenic
938631199 2:133169625-133169647 CTGATGCTTTTACGTTAAAGTGG + Intronic
939170042 2:138685076-138685098 CAGTTGATTTTAAGTTAAAAAGG + Intronic
939867994 2:147496053-147496075 ATGTTGTTTTTTAGGGAAAATGG + Intergenic
940234332 2:151493636-151493658 TTGTTGTTTTTAAGTGGACAAGG + Intronic
940919555 2:159291995-159292017 TTTTTGTTTGTAACTTAAAAAGG + Intergenic
941214852 2:162693936-162693958 CTATTGTTGTTAAATTTAAATGG + Intronic
941351565 2:164443549-164443571 CTATTTTTTTTCAGTTAAGAAGG - Intergenic
943127574 2:183814615-183814637 CTGTTTTTTAAAAGTTTAAAAGG - Intergenic
943964337 2:194313001-194313023 CAGATGTTTTCAATTTAAAATGG + Intergenic
944184476 2:196931665-196931687 TTTTTTTTTTTAAGGTAAAAAGG + Intergenic
945499844 2:210558169-210558191 CTGGTTTTCTTAATTTAAAATGG - Intronic
945581390 2:211599766-211599788 CTCTTGTATTTAAATCAAAAAGG + Intronic
945894930 2:215471064-215471086 CTGTGGCTTATAATTTAAAAGGG - Intergenic
946578332 2:221100611-221100633 ATTTTTTTTTTAATTTAAAATGG + Intergenic
947022703 2:225699064-225699086 CTGTGCTTTTTAAGTTTCAAGGG + Intergenic
947377637 2:229512706-229512728 CTCTTGTTTTTTATTTACAAAGG - Intronic
1169307983 20:4510196-4510218 CTGTTGTTTTTATTTTTAATTGG + Intergenic
1170352310 20:15455213-15455235 CTGCTGTTTTTCTGTTAAATGGG - Intronic
1170563886 20:17582688-17582710 ATGTTGTATTTAACTTAAAATGG + Intronic
1170847801 20:19976642-19976664 TTGTTGTTTTTAATTTTAGAAGG + Intronic
1170946829 20:20898906-20898928 CTGTTGTTTGTAAGTTACTTAGG + Intergenic
1173132817 20:40410598-40410620 CTGTTGTTTGTAAATGACAAAGG - Intergenic
1173707097 20:45118519-45118541 CTTTTATTTTTATGCTAAAAAGG + Intergenic
1174091986 20:48056656-48056678 ATGCTGTTTTTACTTTAAAAGGG + Intergenic
1175755162 20:61525081-61525103 CTGTTGTCATTAAGCTCAAATGG + Intronic
1176211373 20:63924544-63924566 TTTTTGTTTTTAAGTTAAATAGG - Intronic
1176700341 21:10040332-10040354 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1176899578 21:14423106-14423128 CTGTTGTTTTTTGGTTTCAATGG - Intergenic
1177657463 21:24037254-24037276 CTGTTGTTATTAATTTCACATGG - Intergenic
1180029183 21:45191671-45191693 TTTTTGTTTATAAGTTAAATAGG + Intronic
1180221914 21:46364559-46364581 GTGTTTTTTTTAACTTAAACAGG + Intronic
1181379536 22:22490202-22490224 CTGTTGTGTTTAAGTTCAGTGGG - Intronic
1181846921 22:25717824-25717846 TTATTATTTTTAAGATAAAAGGG + Intronic
1181947586 22:26530147-26530169 CTGTTGTTTTTAAGAGACAGGGG + Intronic
1182149519 22:28018342-28018364 CTTTTGTTTTTATTTTGAAAAGG - Intronic
1182872722 22:33662844-33662866 CTCTTGTTTTTAATTTACAATGG - Intronic
1184177698 22:42798622-42798644 CTATCTTTTTAAAGTTAAAAAGG - Intronic
1184709503 22:46240269-46240291 CTGGTGTTTTCATTTTAAAATGG - Exonic
1184986382 22:48138992-48139014 GTGTGGTTTTTGAGTTACAAGGG + Intergenic
1184986395 22:48139072-48139094 GTGTGGTTTTTGAGTTACAAGGG + Intergenic
949534271 3:4983665-4983687 CTTTGGTTTCTAAGTTTAAAGGG - Exonic
949865272 3:8542170-8542192 TTGTTGTTTTTAAGTAGAGATGG + Intronic
950256253 3:11509022-11509044 TTGTTATTTTAAAGTTTAAAGGG - Intronic
951106862 3:18754361-18754383 CTACTGCTTTGAAGTTAAAATGG + Intergenic
951685760 3:25342529-25342551 CTTTTGCTTTTCTGTTAAAAAGG + Intronic
951874728 3:27409652-27409674 CTGTAATTTATAAGTTAAATTGG - Intronic
951925029 3:27900182-27900204 ATTTTGTTTTTCAATTAAAATGG + Intergenic
952408129 3:33023766-33023788 CTGTGGTTTATACGTTAAATGGG - Intronic
952789295 3:37186473-37186495 CTGTTGTTTTTTTTTTAAGATGG - Intergenic
953478003 3:43222269-43222291 ATATTGTTTATAAATTAAAAAGG + Intergenic
955181926 3:56680817-56680839 CTTTTGTCTGTAAGTAAAAATGG + Intronic
956352247 3:68350650-68350672 CTGCTGTTTTTCTGTTAAAAAGG - Intronic
957416709 3:79914849-79914871 CTGTTCTCTTCAAATTAAAATGG - Intergenic
958106977 3:89087734-89087756 CCGTTCTCTTTAAGATAAAATGG + Intergenic
958633902 3:96717745-96717767 ATCTTGTTTTTAAGAAAAAAGGG - Intergenic
958679546 3:97309836-97309858 TTATTGTTTTTAAATTACAAAGG - Intronic
959389240 3:105753366-105753388 CTGTTTTTTTTAAAAAAAAAAGG + Intronic
959540722 3:107534789-107534811 CTGTTGTTTTTATGAAATAATGG + Intronic
959858293 3:111187396-111187418 TTGTTGTTTTTATGTAAAGATGG - Intronic
960116078 3:113894281-113894303 CTGTTGTTTTTTTTTTGAAATGG + Intronic
960807321 3:121596763-121596785 CTTTTTTTTTTAAGGTGAAAAGG - Intronic
960861322 3:122156811-122156833 CTTTTCTTTTTAAGTTACCAAGG + Intergenic
962158186 3:132971211-132971233 GTGTTGTTTTAAACTTCAAAGGG + Intergenic
962510720 3:136097807-136097829 CTTTTTTTTTTAAGTAATAATGG - Intronic
963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG + Intergenic
963563082 3:146891851-146891873 TTGTTCTTTATTAGTTAAAATGG - Intergenic
964034070 3:152174461-152174483 CTGTTGTTTTCAAATTTGAAGGG + Intergenic
964373135 3:156022487-156022509 CAGCTGTTTTTAAGATTAAATGG - Intergenic
964801990 3:160566744-160566766 AATTTTTTTTTAAGTTAAAATGG + Intergenic
965126032 3:164630754-164630776 TTGTTGTTGTTAAGAGAAAAAGG + Intergenic
965268054 3:166573158-166573180 TTGTTGTTTTTGTATTAAAAAGG + Intergenic
965853903 3:173065346-173065368 CTGTTGCTTCTTAGTTCAAATGG + Intronic
965984793 3:174737429-174737451 CATTTGTTGTTAAGGTAAAATGG + Intronic
966000869 3:174946443-174946465 CTGTTTTCTTTTAGTTAAACAGG + Intronic
966451309 3:180066032-180066054 TTGTTTTTGTTAAGTTTAAATGG + Intergenic
966555941 3:181260279-181260301 CTGTGGTTTATAAGTTGAAAGGG + Intergenic
967226395 3:187295709-187295731 ATGAGGTGTTTAAGTTAAAATGG + Intergenic
967629404 3:191727124-191727146 ATGTTGATTTTAAGATATAATGG + Intergenic
967818852 3:193822299-193822321 CTCTTGCTATTAAGTTATAAGGG - Intergenic
967845593 3:194040259-194040281 CTTGTGTTATTAAGTGAAAATGG - Intergenic
968397262 4:252932-252954 TTCATGTTTTTCAGTTAAAAGGG + Intergenic
968584744 4:1411010-1411032 TTCTTGTTTTTAAGTTTAAAGGG - Intergenic
968796298 4:2707347-2707369 CCATTGTTTTTAATTTAAATGGG + Intronic
969953105 4:10860107-10860129 CTGTCTATTTTAAGTTACAAAGG + Intergenic
970357028 4:15265162-15265184 TTGTTGTTTTCAACTTTAAATGG + Intergenic
970930414 4:21504861-21504883 CTATTGATTTTAAGTAAAATGGG - Intronic
971159305 4:24117399-24117421 CTGTTGTTTTTGTATTAACATGG + Intergenic
971689136 4:29810554-29810576 CTGTAGTAGTTAAGGTAAAAGGG - Intergenic
972050791 4:34730369-34730391 TTGATTTTTTTAAGTTGAAATGG - Intergenic
972943915 4:44229725-44229747 CTGTTTGTTTTCATTTAAAAGGG - Intronic
973173695 4:47177223-47177245 CTGTGGCTTTGAAGATAAAAAGG - Intronic
973538065 4:51904720-51904742 TGGTTGTTTTTAAGTGGAAAGGG + Intronic
973894614 4:55398922-55398944 CTTTTTTTTTTAAGTTGCAAGGG + Intronic
975074375 4:70186576-70186598 CTGGTGATTTTTATTTAAAATGG + Intergenic
975229285 4:71912069-71912091 TTTATGTTTTTTAGTTAAAAAGG - Intergenic
975795101 4:77998593-77998615 TTGTTGTTTTTTAGTAGAAAGGG + Intergenic
976469644 4:85413426-85413448 CTGTTGTTTTTTAATTGATAAGG + Intergenic
976642964 4:87358484-87358506 CAGGTTTTTTTAATTTAAAAAGG + Intronic
976706924 4:88028794-88028816 CTGATTTTTTTACTTTAAAATGG - Intronic
976713081 4:88093993-88094015 TTGTTGTTTTTAAATTAACTTGG - Intronic
977088396 4:92635247-92635269 CTGTTGTTTTTAAATTGTGATGG + Intronic
977316016 4:95448869-95448891 CTTCTGTTTTCAAGTTAAACTGG - Intronic
977530535 4:98195383-98195405 TTGTTGTTTTTAATTTTGAAAGG - Intergenic
977746309 4:100551638-100551660 CAGTTGATTTTAAGTTAGTATGG - Intronic
977800893 4:101229838-101229860 CAGTTGTTTTTAAGGCAAATAGG + Intronic
978198620 4:105998793-105998815 CTGTTTTGTTCATGTTAAAATGG - Intronic
978220602 4:106269278-106269300 CTTTTGTGTTCAAGTTATAAAGG - Intronic
978571040 4:110137820-110137842 CTGTTGTTTTGAAATTAAAGTGG - Intronic
978958316 4:114642303-114642325 GTGTTGTTTTGCAGTTTAAATGG + Intronic
979467959 4:121061975-121061997 ATGTTCTTTTAAAATTAAAAAGG + Intronic
979472316 4:121113988-121114010 CTTTTGATTTTTAGTCAAAATGG + Intergenic
980296124 4:130920160-130920182 CTGTTGTTTTGAAGTAAAAATGG - Intergenic
980372754 4:131899111-131899133 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
980528975 4:134026057-134026079 CTGTTCTTTCTACATTAAAAGGG - Intergenic
980959079 4:139456385-139456407 CTGTTATCTTTAAGTATAAATGG - Intronic
981245107 4:142526238-142526260 AATTTGTTTTTAAGATAAAAGGG - Intronic
981620900 4:146697582-146697604 CTGTTGCTTCTAAGATAGAAGGG + Intergenic
981836343 4:149058669-149058691 TTATTCTTTTGAAGTTAAAAAGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982540964 4:156670402-156670424 CTGTTATTTTGATGTTAAAATGG - Intergenic
984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG + Intronic
984683003 4:182632598-182632620 CTTTTCTTTTTGATTTAAAAAGG + Intronic
984993793 4:185408236-185408258 CAGTTGATTATAATTTAAAACGG + Intronic
985310458 4:188592192-188592214 CTTTTTTCTTTTAGTTAAAAAGG - Intergenic
986460799 5:7969871-7969893 CTTATGTTTTTAAATTTAAAAGG + Intergenic
986702436 5:10424028-10424050 CTTGTTTTTTTTAGTTAAAATGG + Intronic
986875596 5:12104180-12104202 ATGTTGTTTTTTAGTTAAGTAGG + Intergenic
987018091 5:13841444-13841466 GTATTGTCTTTAATTTAAAACGG - Intronic
987995645 5:25274867-25274889 ATCTTATTTTTTAGTTAAAACGG + Intergenic
988656923 5:33221828-33221850 CTGTTGTTTTTATGGTACTAAGG + Intergenic
989091764 5:37741246-37741268 TTTTTTTTTTTAATTTAAAAAGG + Intronic
990132486 5:52604057-52604079 CTGTTTTTTATGAGTAAAAATGG - Intergenic
990961443 5:61397920-61397942 CTTTTGTTTTGAAGGTAAAGTGG - Intronic
990974325 5:61544392-61544414 CTCTGTTCTTTAAGTTAAAAAGG - Exonic
991004666 5:61815956-61815978 TTGTTGTTTTTAATTTTAATCGG - Intergenic
991051977 5:62282636-62282658 CAAATGTTTTTACGTTAAAATGG - Intergenic
991967901 5:72109224-72109246 TTTTTTTTTTTAAGCTAAAAGGG - Intronic
992703386 5:79363055-79363077 ATGGTGTTTTTAAGCTAAGAGGG - Intergenic
993493134 5:88576642-88576664 GTGTCTTTTTTAAGCTAAAAGGG + Intergenic
993617677 5:90133608-90133630 CCCTTGTTCTTAATTTAAAATGG + Intergenic
993864923 5:93181647-93181669 CTGTAGTTTATAATTTATAAGGG - Intergenic
994178244 5:96735373-96735395 TTGTTGGGTTTAAGATAAAAGGG - Intronic
994997880 5:107087534-107087556 CTTTTTTTTTTAACTTAAAAAGG + Intergenic
995076498 5:107990993-107991015 CTTTTGTTTTTATTTGAAAAGGG + Intronic
995508861 5:112887925-112887947 CTTTTCTTTTTATCTTAAAAAGG - Intronic
995929407 5:117419876-117419898 CTGTTGGTTGTAATGTAAAATGG - Intergenic
996449558 5:123604180-123604202 ATGTGGGTTTTAAGTTAAAGAGG + Intronic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
997783424 5:136683284-136683306 CTGTTTTTTTTTATTTAAAAGGG + Intergenic
998506533 5:142676887-142676909 TTTTTGTTTTGAAGTAAAAATGG - Intronic
998540538 5:142977412-142977434 CTGTTGTTTTTTTTTTAATAAGG - Intronic
999722093 5:154405871-154405893 CTGTTGTTTTTTTTTTTAAAAGG + Intronic
1000185518 5:158854236-158854258 TTATTGTTTTTATTTTAAAATGG - Intronic
1000415287 5:160977848-160977870 ATGTTGTTTTTATGATTAAATGG - Intergenic
1002008742 5:176259163-176259185 CTAATGTTTATAATTTAAAATGG - Intronic
1002217980 5:177653089-177653111 CTAATGTTTATAATTTAAAATGG + Intergenic
1002922582 6:1583017-1583039 ATGTAGTTTTAAAGTTAATATGG + Intergenic
1003385625 6:5664979-5665001 TTGTTGTTTTAAAGAGAAAAGGG + Intronic
1004046832 6:12033535-12033557 CTGTGATATTTAAGTTAATATGG + Intronic
1004051682 6:12087147-12087169 CTGTTATTATCAAGATAAAAAGG + Intronic
1004062420 6:12210694-12210716 CAGTTGTGTTTAATTTACAAAGG - Intergenic
1004419609 6:15456846-15456868 CTGTTTTTCTTAAATTAAAATGG - Intronic
1004783476 6:18938930-18938952 TAGTTTTCTTTAAGTTAAAAAGG + Intergenic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1004847420 6:19660736-19660758 CTTCTGTTTTTAATTTTAAAGGG + Intergenic
1005004368 6:21273072-21273094 TTTTTTTTTTTAAGTTAAATAGG + Intergenic
1005245544 6:23880373-23880395 GTGTTGTTTTGAAGATTAAATGG - Intergenic
1005330655 6:24746746-24746768 CAGTTGTTTGTTAGTTTAAACGG + Intergenic
1005347630 6:24906034-24906056 CTGTTGTTTTTCAGTACATAAGG + Intronic
1007147817 6:39654225-39654247 CTGTTTCTTTGAAGATAAAATGG + Intronic
1007682498 6:43644320-43644342 CTGTTGTTTTTAGATCCAAATGG - Intergenic
1008007402 6:46425707-46425729 CTGTTTTTTTTAAGGTAAGTAGG - Intronic
1008233651 6:49016357-49016379 CTGGTGTTTTTATGAAAAAATGG + Intergenic
1008788258 6:55197076-55197098 CAGTTGGTTTTAGGGTAAAAGGG - Intronic
1009662237 6:66629215-66629237 TTTTTTTTTTTAAGTTCAAAAGG - Intergenic
1010934269 6:81842177-81842199 CATTTTTTTTTAAATTAAAATGG + Intergenic
1011018503 6:82784868-82784890 TGGTTGTTTTTAAGTTCAAATGG - Intergenic
1011586298 6:88929258-88929280 TTTTTTTTTTTAGGTTAAAATGG - Exonic
1011988929 6:93487628-93487650 TTCTTGTTTTTAAGCCAAAAGGG - Intergenic
1012291922 6:97466659-97466681 CAGTTTTTTTTAAGTATAAAAGG - Intergenic
1013451386 6:110285324-110285346 CTTATGTTTTTAACTAAAAACGG + Intronic
1013789449 6:113819829-113819851 TTGTTGTTTCTAAATAAAAATGG + Intergenic
1013803026 6:113969377-113969399 CTGTCTCTTTTTAGTTAAAAAGG - Intronic
1013839985 6:114379947-114379969 CTGTTGTTTTAAACATTAAAAGG + Intergenic
1014263292 6:119245765-119245787 CTGATGTTTTGAAGTTAAACTGG - Intronic
1014273510 6:119361218-119361240 GTATTGTTTTAAAGTCAAAAGGG - Intergenic
1015358840 6:132312796-132312818 TTTTTTTTTTTAAGTTTAAATGG - Intronic
1015424278 6:133047621-133047643 CTCACGTTTTTAAGCTAAAATGG - Intergenic
1015774461 6:136799701-136799723 CTATTGTGCTTATGTTAAAAAGG + Intergenic
1016724582 6:147347484-147347506 GTGTAGCTTTTAAGTTTAAATGG - Intronic
1016969283 6:149747782-149747804 CTGTTGTTTTTATGTGATATTGG + Intronic
1017894006 6:158663591-158663613 CTCTTGTTATTCATTTAAAACGG + Intronic
1017940249 6:159046495-159046517 CTGATTTTTTTAATTGAAAAAGG + Intergenic
1018056795 6:160059113-160059135 ATGTTGTTTTGTAGCTAAAAAGG + Intronic
1018450799 6:163905591-163905613 TTTTTTTTTTTAATTTAAAATGG + Intergenic
1018492332 6:164306715-164306737 ATTTTATTTTTAATTTAAAAAGG - Intergenic
1020925947 7:14324700-14324722 CTGCTATTTTTAAATTAAAAAGG - Intronic
1020926299 7:14330498-14330520 CTGTTATATTCAATTTAAAATGG + Intronic
1020932151 7:14411305-14411327 TTGTAGTTTTCAAGTTACAATGG + Intronic
1021663534 7:22947595-22947617 CTAGTGTTTTTAAGATAATATGG + Intronic
1021677250 7:23093590-23093612 ATGTTGTTTTTTTTTTAAAAAGG - Intergenic
1021741274 7:23688002-23688024 CTCTTTTTGCTAAGTTAAAATGG + Intronic
1021778078 7:24073428-24073450 CTTTAGTTTTTAAAATAAAATGG - Intergenic
1022753809 7:33262218-33262240 CTGCTGTTTTAATGTTAATAAGG + Intronic
1022839866 7:34153543-34153565 CAGGTGTTTTTAATTTAATAAGG + Exonic
1023499756 7:40834954-40834976 TTTTTTTTTTTAATTTAAAAAGG - Intronic
1023748368 7:43344964-43344986 TTTTTGTTTTTAATTTAGAAAGG + Intronic
1024304590 7:47916983-47917005 CTATTCTTTTTAAGGTAAACTGG - Intronic
1026032696 7:66808157-66808179 CTGTTGTTGTTAAGTGAAAGAGG + Intronic
1027584401 7:80040149-80040171 CAATTTTTTTTAAGATAAAAAGG - Intergenic
1028469765 7:91192573-91192595 CTGATGTTTTTACCTTAAAAGGG + Intronic
1029287207 7:99473919-99473941 CTGTTGTTTTTAAGAGAGACAGG + Intronic
1030335846 7:108324966-108324988 CTATTGTTTTTAAGTAATCAGGG - Intronic
1030747983 7:113191585-113191607 TTGTTTTTTTGAAGATAAAATGG + Intergenic
1031153819 7:118085752-118085774 CTTTTATTTTTAATTTAACATGG - Intergenic
1032730158 7:134633509-134633531 CTGTTATTGTGAAGATAAAATGG - Intergenic
1033449963 7:141453910-141453932 CTTTTTTTTTTTAGATAAAAGGG - Intronic
1033632194 7:143169732-143169754 CTGTTGTTGAGAAGGTAAAATGG + Intergenic
1033680560 7:143590780-143590802 CTGTGGTTTTGAAGTAAAATTGG - Intergenic
1033704334 7:143871032-143871054 CTGTGGTTTTGAAGTAAAATTGG + Intronic
1033930652 7:146516394-146516416 CTGTTTTTGTTAAATGAAAAAGG + Intronic
1034784466 7:153912875-153912897 CTATTTTTCTTAAGTTAGAATGG - Intronic
1035794903 8:2346570-2346592 CTTTTTTTTCTAAGTTAACATGG + Intergenic
1036968903 8:13332136-13332158 GTTTTGTTTTTAATTTAAAGGGG - Intronic
1036985446 8:13523856-13523878 CTTTTTTTTTTAAATTAATATGG + Intergenic
1037491608 8:19401735-19401757 CAGTTGTTTTAAAGATTAAATGG - Intergenic
1039161358 8:34625356-34625378 CTGTGGTATTTAAATTAAATGGG + Intergenic
1039436757 8:37564672-37564694 TTCTTGTTTTTAGGCTAAAATGG - Intergenic
1039739310 8:40366735-40366757 CTGTTGTTTTTATCACAAAAAGG + Intergenic
1039939336 8:42075962-42075984 TTGTTGTTTTTTAAATAAAAGGG + Intergenic
1040418088 8:47214109-47214131 CTGTTGGTTTAAAATTAAAAAGG - Intergenic
1040863355 8:52023300-52023322 GTATTCTTTATAAGTTAAAATGG + Intergenic
1040973018 8:53158013-53158035 CTGCTGTTTATACATTAAAAAGG - Intergenic
1041561253 8:59221511-59221533 CAGTTTTTTTAAATTTAAAATGG - Intergenic
1042594175 8:70427984-70428006 AGGTTTTTTTTAAGTGAAAAAGG + Intergenic
1042860160 8:73304730-73304752 CTGTTGTCTTCAAGTAAAACAGG - Intronic
1044017721 8:87065617-87065639 CTGATGTTTTTAAATGGAAAAGG - Intronic
1044386614 8:91596894-91596916 CTTTTATTTTCAAGTGAAAAAGG + Intergenic
1044589691 8:93902003-93902025 ATTTTGTAATTAAGTTAAAAGGG - Intronic
1045570222 8:103361243-103361265 CAGTTGACTTTAACTTAAAAGGG + Intergenic
1045657947 8:104406295-104406317 CTGTTGTTTTCTCCTTAAAATGG + Intronic
1046028654 8:108756354-108756376 CTTCTATTTTTAAGTTAGAAAGG - Intronic
1046370413 8:113298490-113298512 TTGCTGATTTTAAGTTTAAAAGG - Intronic
1046416940 8:113928736-113928758 CAGCTGCTTTTAAGTCAAAATGG + Intergenic
1047321467 8:123788465-123788487 CTTTTTTTTTTAAGATATAAAGG - Intronic
1047467612 8:125133131-125133153 CTGCAGTTTTTAATTTAAAATGG - Intronic
1048584934 8:135767096-135767118 CTGCAGCTGTTAAGTTAAAAGGG - Intergenic
1049923305 9:385020-385042 CTGATTTTTGTAAGTCAAAAAGG - Intronic
1050326870 9:4506373-4506395 CTTTTGTTATTAAGTGGAAAAGG + Intronic
1050796666 9:9554429-9554451 CTCTTGTTTTTAGGTTACACTGG + Intronic
1051316396 9:15837903-15837925 GTGTTGTTTTGAAGTAAAAGAGG - Intronic
1052282555 9:26749510-26749532 TATTTGTTTTTAGGTTAAAATGG + Intergenic
1052711312 9:32060172-32060194 CTGCTGTTTATATTTTAAAAGGG - Intergenic
1053334343 9:37251246-37251268 TTGATTTTTTTAAATTAAAAAGG - Intronic
1053453426 9:38212362-38212384 CTTTTTATTTTATGTTAAAAGGG + Intergenic
1053637542 9:40027154-40027176 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1053768539 9:41438085-41438107 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1053826701 9:42032366-42032388 CTGTGGATTTTAAGTGAAGATGG - Intronic
1054547207 9:66349566-66349588 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1054603858 9:67155057-67155079 CTGTGGATTTTAAGTGAAGATGG + Intergenic
1054862939 9:69971933-69971955 CGGTTGGGTTTAAGTGAAAAAGG - Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055329837 9:75172351-75172373 ATTTTATTTTTAAGTTCAAAGGG + Intergenic
1055412337 9:76043998-76044020 CAGTTTTTTTTAAATAAAAAAGG + Intronic
1055994721 9:82145087-82145109 GTGCTTTTTTTAAGTAAAAATGG + Intergenic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1056066862 9:82944547-82944569 CATTTCTTTTTAATTTAAAAAGG - Intergenic
1057420567 9:94908910-94908932 AAGTTATTTTTAAGTTAGAAAGG - Intronic
1057745460 9:97747501-97747523 CTGTTGTTATTAAGAGAAAGAGG - Intergenic
1057789171 9:98111400-98111422 TTGTTGTTTTTTGGTAAAAATGG - Intronic
1059124490 9:111671053-111671075 CTGTTGTTGTTAAGACAGAATGG - Intergenic
1059631809 9:116132914-116132936 CTGCTGTATTAAATTTAAAAAGG + Intergenic
1062088336 9:134660272-134660294 CTCTTGGTTTTCACTTAAAATGG + Intronic
1202785351 9_KI270719v1_random:10397-10419 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1185592357 X:1285964-1285986 CTGTTGCTTTTAACTCAGAAAGG - Intronic
1186004201 X:5050237-5050259 TTGTTGTTTTATAGGTAAAATGG - Intergenic
1186780957 X:12911540-12911562 CTGATGTCATCAAGTTAAAATGG - Intronic
1187790244 X:22942499-22942521 ATTTTGTTTTTATTTTAAAATGG + Intergenic
1188777277 X:34235529-34235551 CTGAGTTTTTTAAGTTAAAAGGG + Intergenic
1189237779 X:39501514-39501536 ATATGGTTTTTAAGTCAAAAAGG + Intergenic
1189373553 X:40448748-40448770 CTGTTGTTTTTGAATTTAATTGG + Intergenic
1190780196 X:53586655-53586677 CTGTAGTTTTAAAATTATAAAGG - Intronic
1192119687 X:68443491-68443513 CTGTTCTTCTTAAGCTAAACAGG - Intergenic
1192715474 X:73636745-73636767 CAGTTGTTATTAATTTAAAGTGG - Intronic
1194395169 X:93374364-93374386 CAGAAGTATTTAAGTTAAAATGG + Intergenic
1195238666 X:102928403-102928425 CAGTTGTCTTTAAGGTACAATGG - Intergenic
1195466501 X:105184335-105184357 AAATTTTTTTTAAGTTAAAAAGG - Intronic
1195472667 X:105249474-105249496 CTGTACTTTTTATTTTAAAATGG - Intronic
1195654454 X:107321762-107321784 AGGTGGCTTTTAAGTTAAAATGG - Intergenic
1196288117 X:113906151-113906173 TTGTAGTTTTTAAGTAACAATGG + Intergenic
1196528244 X:116751770-116751792 CTGTTGGCTTTAATTCAAAAAGG - Intergenic
1198216774 X:134562736-134562758 CTGTTGTTCTTCACTTGAAATGG + Intergenic
1199037487 X:143069806-143069828 GTGTTTTTTTTAAGATAAAGAGG + Intergenic
1199651530 X:149949580-149949602 CTTTTGCTTTTCAGTGAAAATGG - Intergenic
1200185349 X:154179264-154179286 CTTTTTTTTTTAAATTGAAATGG + Intergenic
1200191002 X:154216402-154216424 CTTTTTTTTTTAAATTGAAATGG + Intergenic
1200196753 X:154254204-154254226 CTTTTTTTTTTAAATTGAAATGG + Intergenic
1200202408 X:154291322-154291344 CTTTTTTTTTTAAATTGAAATGG + Intronic