ID: 1127745900

View in Genome Browser
Species Human (GRCh38)
Location 15:61971831-61971853
Sequence TGTACACACCTAAGTACTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127745900_1127745901 16 Left 1127745900 15:61971831-61971853 CCAATAGTACTTAGGTGTGTACA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1127745901 15:61971870-61971892 TATTTCTGACATTATATTTTAGG 0: 1
1: 0
2: 6
3: 93
4: 913

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127745900 Original CRISPR TGTACACACCTAAGTACTAT TGG (reversed) Intronic
903001523 1:20269478-20269500 TGTAAACACACCAGTACTATTGG - Intergenic
916307065 1:163348612-163348634 TGTACACACTTAGGTACTGTTGG - Intronic
919856442 1:201709490-201709512 TGTACACAGGTAAGTCCTCTTGG + Intronic
920217577 1:204372096-204372118 TGTTGACACATAAGGACTATGGG - Intronic
1064489421 10:15835746-15835768 TCTACACAACTAAGCACTTTGGG + Intronic
1069102453 10:64339308-64339330 TGTACAAACCTAATTATCATTGG - Intergenic
1070454384 10:76596441-76596463 TGTCCAAACCTAAGAATTATAGG - Intergenic
1070551178 10:77491916-77491938 TGAACACATCTAAGGGCTATGGG - Intronic
1071470158 10:85978453-85978475 TGTACAAACCTAAGCATTAATGG + Intronic
1072168021 10:92832585-92832607 TGTACACTCTTAAGCATTATGGG + Intergenic
1072370407 10:94760782-94760804 TGGACTCACCCAAGTACTAAAGG + Intronic
1072796042 10:98355321-98355343 TGTACACACCCAATTAATGTGGG - Intergenic
1084760971 11:71270616-71270638 TGTACATTCCTAATTATTATTGG - Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1089837091 11:121380231-121380253 TGTACAAACCTAAGAATGATTGG + Intergenic
1092695498 12:11167008-11167030 TGAACCCACCTAAATAATATGGG + Intronic
1093608856 12:21129126-21129148 GGTACACACCTGAGAACTCTGGG + Intronic
1099178339 12:79449179-79449201 TGTAAATACCTCAGTAATATGGG + Exonic
1108605758 13:52036885-52036907 TGTACCCAAATAAATACTATAGG + Intronic
1111545118 13:89723031-89723053 TGTACACTCCTGAATATTATGGG + Intergenic
1111833005 13:93353719-93353741 ATTACTCACCTAAGTACTATAGG + Intronic
1116053164 14:39829611-39829633 TGAACACACCCAAGAATTATAGG + Intergenic
1116077516 14:40130057-40130079 TGTATACAATTAAATACTATAGG - Intergenic
1116500367 14:45614031-45614053 TGTACACACCAAAGTAACCTTGG - Intergenic
1117581509 14:57156114-57156136 TATACTCACCTCAGTATTATGGG + Intergenic
1120729139 14:87982196-87982218 TGTACACACCTTAATATAATTGG + Exonic
1125834961 15:42741012-42741034 TGCACTTACCTAAGAACTATAGG + Exonic
1127745900 15:61971831-61971853 TGTACACACCTAAGTACTATTGG - Intronic
1130885930 15:88092548-88092570 TGGACACACCTTCATACTATTGG - Intronic
1131940643 15:97561310-97561332 TGTACATACTTACATACTATGGG - Intergenic
1144602663 17:16631954-16631976 TGAACAGTCCTAAGTACTAAAGG + Intronic
1149203210 17:54212654-54212676 TGTACACTCCTAAGATCTAGTGG + Intergenic
1160402956 18:78624474-78624496 TTTACACAGCTAAGCACTGTGGG + Intergenic
925500055 2:4492717-4492739 TATACACAGCTAACTCCTATAGG + Intergenic
927645829 2:24876336-24876358 AGCTCACACCTAAGTGCTATAGG - Intronic
930123230 2:47776671-47776693 TGTACTCCCCTAAGTACCAAAGG - Intronic
933434526 2:82229877-82229899 TGTATTCAGCTAGGTACTATAGG + Intergenic
944609880 2:201392066-201392088 AATACACACTTAAGTACTACGGG + Intronic
947864229 2:233384954-233384976 TGTACACACCAGAGTGCTCTGGG - Intronic
1170559616 20:17545625-17545647 TGTAAACACCTTAGGACCATGGG - Intronic
1173907155 20:46637650-46637672 GATACACCCCTAAGTACTCTGGG + Intronic
1174113080 20:48209652-48209674 TGTTCACACCTAAGCACAAGAGG + Intergenic
1174969006 20:55252942-55252964 TCTCCACACCTCTGTACTATGGG + Intergenic
1184938953 22:47746869-47746891 TGTAAACATCTAAGGACCATGGG + Intergenic
951172030 3:19553997-19554019 TGCACAAACCAAAGAACTATTGG - Intergenic
951421381 3:22489850-22489872 TGTACACACCAAAGAACTATGGG + Intergenic
961228148 3:125273379-125273401 TGTATACATCTAAGAACTAAAGG + Intronic
962116215 3:132510926-132510948 TGAATACACCTATGCACTATAGG - Intronic
978086799 4:104664934-104664956 TGTAGACAGTTATGTACTATGGG + Intergenic
978469884 4:109053601-109053623 TGAACAGATCTAAGTACTAGGGG - Intronic
979318238 4:119292579-119292601 TCTTCACACCTAAGAACTGTTGG + Exonic
985960287 5:3297080-3297102 TGAACACACCACAGCACTATCGG + Intergenic
987849053 5:23325278-23325300 TGTACACATCTTGGTACTAGTGG + Intergenic
991187875 5:63831747-63831769 TGTACCCACCTAACTCCTGTGGG + Intergenic
994115086 5:96052745-96052767 TGTACATGCCTAAATACTTTGGG + Intergenic
996412387 5:123172451-123172473 TCTGCACATCTTAGTACTATTGG + Intronic
996997411 5:129714542-129714564 TGCACACACAGAAGTAATATGGG + Intronic
998378118 5:141704676-141704698 TGTACAAACCTAAGAACAATGGG + Intergenic
1000334052 5:160228900-160228922 TCTACACATCCAAGTCCTATTGG + Intronic
1003353838 6:5346280-5346302 TTTATTCACCCAAGTACTATGGG - Intronic
1003909331 6:10729054-10729076 TCTACACATCTAAGAAATATGGG - Intronic
1003912549 6:10755542-10755564 CCTACACACCTAAGAAATATGGG - Intronic
1008018658 6:46550666-46550688 TGTACACACCTGAAGGCTATAGG + Intronic
1012774881 6:103485825-103485847 TGTACACCCCTATGTAATACTGG - Intergenic
1015096495 6:129419903-129419925 TGTACATTTTTAAGTACTATAGG - Intronic
1016136717 6:140553542-140553564 AGAACACACCTAAGAATTATTGG - Intergenic
1016499015 6:144697191-144697213 TGTACATATCAAAGTACTAAAGG + Intronic
1020119562 7:5495486-5495508 TGGACACACCTCAGTAGTAAGGG - Intronic
1028355728 7:89904319-89904341 TGTACACACATATGTACAAAAGG + Intergenic
1028527077 7:91798332-91798354 TGTAAACCCCTAAGTAATACAGG + Intronic
1033783189 7:144697325-144697347 GCTACACAGCTAAGTATTATGGG - Intronic
1041299434 8:56395332-56395354 TGCAGACACCTCAGTACTTTTGG - Intergenic
1043558038 8:81457084-81457106 TGTACACACTCAAGTCCTTTAGG + Intergenic
1046012592 8:108568240-108568262 AATACACAACTAAGTACTCTTGG - Intergenic
1046644400 8:116769064-116769086 TGTAGAGACCTAACTACTAGTGG - Intronic
1047425732 8:124744093-124744115 TATACACACATAAGTATTTTAGG - Intergenic
1050554445 9:6776969-6776991 TATACAAACCTAAGTGCTATAGG - Intronic
1052799422 9:32953895-32953917 TGTAAACATCTAAGGACCATGGG + Intergenic
1056323119 9:85455533-85455555 AGTATACACCCAAGTACTTTTGG + Intergenic
1188178964 X:27029816-27029838 TGTACATGCCTTAGTACTTTTGG - Intergenic
1192621886 X:72684878-72684900 TGTACAAACCTAAGCACTTGGGG + Intronic
1192720113 X:73686367-73686389 TGTACACACCTAAATAAATTAGG - Intronic
1198884512 X:141319691-141319713 TGTACAAAGCAATGTACTATTGG + Intergenic
1199121712 X:144061964-144061986 TGTACAAACCTAAGAATAATTGG + Intergenic
1200352629 X:155514717-155514739 ATCACACAACTAAGTACTATAGG + Intronic
1201156691 Y:11136966-11136988 TGTACACCCCCATGTGCTATTGG + Intergenic