ID: 1127748861

View in Genome Browser
Species Human (GRCh38)
Location 15:62010767-62010789
Sequence ATGCATAATAATAAGCTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127748860_1127748861 13 Left 1127748860 15:62010731-62010753 CCAAAAAATATTTAAGCAATTTA 0: 1
1: 0
2: 9
3: 108
4: 1087
Right 1127748861 15:62010767-62010789 ATGCATAATAATAAGCTCGATGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127748861 Original CRISPR ATGCATAATAATAAGCTCGA TGG Intronic
900032783 1:383110-383132 ATGCAAAATAATAATCTCCAAGG - Intergenic
900053626 1:613000-613022 ATGCAAAATAATAATCTCCAAGG - Intergenic
904780032 1:32939472-32939494 ATGCATAATAATAAGTAGGCAGG - Intronic
905623631 1:39471244-39471266 ATGGATTATAATAAGTTAGAAGG + Intronic
907710346 1:56875156-56875178 ATGCATTTTAATAAGCTCCCTGG - Intronic
910026983 1:82667134-82667156 ATGAATAGTAAAAAGCTCGGAGG + Intergenic
915919837 1:159967283-159967305 ATGCATAAAAATCAACTCAAGGG - Intergenic
919392800 1:197009013-197009035 AAGCATCATAATATGCTGGAAGG + Exonic
1063791999 10:9461074-9461096 ATGCAGAAAAATAATCTCGTAGG - Intergenic
1068911612 10:62383977-62383999 CTGCATAATAATGAGCTTCAAGG + Intronic
1070028607 10:72655630-72655652 ATGCATTATAATCACCTGGAAGG + Intergenic
1070804388 10:79262347-79262369 ATGCATTAGAATAATCTGGAAGG - Intronic
1071011735 10:80948165-80948187 ATGCAAAATAATGAGCTCATTGG + Intergenic
1075588124 10:123671991-123672013 AATCATAATAATAAGCAAGAGGG + Intronic
1076318554 10:129561623-129561645 ATGCATAATTACATGCTTGAGGG - Intronic
1081033116 11:38111715-38111737 ATGCTTAATAAGAAGGTCCAGGG - Intergenic
1081033869 11:38117287-38117309 ATGCTTAATAAGAAGATCCAGGG - Intergenic
1085163052 11:74366793-74366815 ATGCAGACTTATAAGCTCCAAGG + Intronic
1087586186 11:100124920-100124942 ATGCATAAAATTAATCTGGATGG + Intronic
1092518290 12:9239127-9239149 TTGCCTAATAATAAGGTCTAAGG - Intergenic
1093959941 12:25261365-25261387 ATGTATAAGAATAAGTTCAAAGG - Intergenic
1095492591 12:42750025-42750047 ATACATAATAATAAGACAGAGGG + Intergenic
1098411363 12:70187721-70187743 ATACATAATAGTAATCTCGTTGG - Intergenic
1102933146 12:116877627-116877649 ATGCACAATAATAATCATGATGG + Intronic
1102969869 12:117157878-117157900 ATGCTTCATAATGAGCCCGATGG + Exonic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107279987 13:38722550-38722572 ATGCATCAAAATAACCTGGAGGG + Intronic
1107843395 13:44483930-44483952 ATTCATAAAAATAATCTAGAAGG - Intronic
1108779399 13:53810556-53810578 GTACATAATAATAAGCTGGATGG - Intergenic
1109156244 13:58913613-58913635 ATAGATAAAAATAAGCTCCAAGG + Intergenic
1111306576 13:86420616-86420638 ATGCTTAATAACAAGCCCCAAGG - Intergenic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116209781 14:41921196-41921218 ATGCACAATAGTAAGCTTAATGG + Intergenic
1116502991 14:45643294-45643316 ATTCATAATAAAAAACTAGAAGG + Intergenic
1117816373 14:59602801-59602823 ATGCATGATATTAAGCTCTAAGG - Intronic
1120060405 14:79975932-79975954 ATGCATCATAATCACCTAGATGG - Intergenic
1124873104 15:33563406-33563428 TTGCATAATAACAAGCCCGCAGG + Intronic
1127748861 15:62010767-62010789 ATGCATAATAATAAGCTCGATGG + Intronic
1138112282 16:54333658-54333680 ATGCATAATAAATAACACGATGG - Intergenic
1147346948 17:39804616-39804638 ATGCATCAGAATAAGGTCCATGG + Intronic
1149969710 17:61204716-61204738 ATGCTTATTAATAAGTTCCAAGG - Intronic
1152194405 17:78908695-78908717 ATGCATAAAAATACTGTCGAGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155728040 18:29114513-29114535 ATACATAAAAATAAGCAAGATGG + Intergenic
1155877364 18:31102804-31102826 CTGCAAAATAATAAAATCGAGGG + Intergenic
1158190939 18:54828250-54828272 ATGAATAAAAATGAGCTCGCTGG + Exonic
928753750 2:34499816-34499838 ATCCATATTACTAAGCTTGAAGG + Intergenic
929374228 2:41265457-41265479 ATGAAAAATAAGAAGCTCAAAGG - Intergenic
930606063 2:53494354-53494376 ATGCAGAATCAGAAGCTCTAGGG - Intergenic
933605201 2:84375411-84375433 ATGCAATATAGTAAGCTCCAGGG + Intergenic
935667260 2:105523530-105523552 AGGAATAATAATCAGCTGGAGGG + Intergenic
939842820 2:147209006-147209028 ATGCATAAAAATCAACTGGAGGG - Intergenic
940466923 2:154042675-154042697 ATGCATAATGATAAGGACTAGGG - Intronic
941074325 2:160989853-160989875 CTGCATCATAATAATCTCAAGGG - Intergenic
944897048 2:204176004-204176026 AAGCATAATAATAAGCACCCGGG - Intergenic
1173635274 20:44550851-44550873 TTTCATAATAAAAAGCTAGAGGG - Intronic
1181380015 22:22494687-22494709 ATGCATAGAAATAATCTGGAAGG - Intronic
1184883972 22:47330874-47330896 ATCCATAATAATAAACTCTCAGG + Intergenic
949318058 3:2778682-2778704 ATGCATTATAATAAGTTGGATGG - Intronic
949574072 3:5321888-5321910 ATGCACAAGAATAAGCTCAGAGG + Intergenic
950911830 3:16603846-16603868 ATGCATAAAAATAATCTAGAAGG + Intronic
951846580 3:27091008-27091030 ATGCATAATAATTATCTGGGAGG + Intergenic
953520787 3:43640713-43640735 ATTCATAATAATGACCTTGAAGG + Intronic
956581116 3:70814832-70814854 ATGCTTAATGATAAGCCTGAAGG - Intergenic
957661252 3:83156323-83156345 ATGCATTAGAATAACCTGGAAGG - Intergenic
974210427 4:58766608-58766630 ATGCATAATAATAACATAAAGGG - Intergenic
974519478 4:62963596-62963618 ATGCATAGTAGTATGCTCCAAGG + Intergenic
974562489 4:63540271-63540293 AAGCATAATTTTAAGCTTGATGG - Intergenic
975134966 4:70865878-70865900 ATGCTTAATAATAAGTTGCAAGG + Intergenic
984113607 4:175650136-175650158 AAGCAGAATAATATGCTCTATGG - Intronic
990847663 5:60162070-60162092 ATGCCCTTTAATAAGCTCGAGGG + Intronic
991567738 5:68021942-68021964 ATGCATCATAATCACCTCAAGGG - Intergenic
997075415 5:130669100-130669122 AAATATAATTATAAGCTCGAAGG - Intergenic
1002741037 5:181435758-181435780 ATGCAAAATAATAATCTCCAAGG + Intergenic
1004040925 6:11974621-11974643 ATGCAGAATAAAAAGTTCTATGG - Intergenic
1006765595 6:36502373-36502395 ATTCATAATAAAAACCTGGATGG - Intronic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1012612479 6:101232744-101232766 ATGCATAAAAAAGAGCTGGAAGG - Intergenic
1018776118 6:167017788-167017810 AAGACTAATAATAAGCTCTATGG - Intronic
1019246142 6:170711353-170711375 ATGCAAAATAATAATCTCCAAGG + Intergenic
1021277461 7:18671282-18671304 ATGCATAACAATCCTCTCGAGGG + Intronic
1032730228 7:134634369-134634391 ATGCAAAGTAATAAGCTCATAGG - Intergenic
1032904039 7:136343743-136343765 ATGCATCATAATTACCTGGAGGG - Intergenic
1033102020 7:138481999-138482021 ATACATAATTATAAGCACGGCGG - Intronic
1033575829 7:142683790-142683812 ATACAGAATTATAAGCCCGATGG + Intergenic
1034182763 7:149151009-149151031 ATGAATAAGAATCAGCTGGAGGG - Intronic
1035501978 8:96845-96867 ATGCAAAATAATAATCTCCAAGG - Intergenic
1040843599 8:51810911-51810933 GTGTATAATAATTAGGTCGAAGG + Intergenic
1044146927 8:88728398-88728420 AAGGATAAGAATAAGCTAGAAGG + Intergenic
1048721792 8:137334090-137334112 ATGCATAATAATTGGCTCTTGGG + Intergenic
1050574464 9:6978924-6978946 ATGAATATTAATAAGGTCAAAGG + Intronic
1050927629 9:11285584-11285606 AGGCATAATAATAAGCAAAATGG - Intergenic
1051587757 9:18745254-18745276 ATGCTTATTAATAATCTAGAAGG - Intronic
1054982929 9:71227517-71227539 ATGAATAATAAAAAGAGCGATGG + Intronic
1055332877 9:75202210-75202232 ATGCATACTAAAGAGCTCCAGGG + Intergenic
1058001663 9:99872133-99872155 ATGCATCATAATTACCTGGAGGG - Intergenic
1058206210 9:102111674-102111696 CTGCAAAATAATAAGCAAGATGG - Intergenic
1059634269 9:116156009-116156031 ATCCATAATAATAATGACGATGG + Intronic
1203606344 Un_KI270748v1:60565-60587 ATGCAAAATAATAATCTCCAAGG + Intergenic
1186681887 X:11883495-11883517 AAGCATTATACTAAGCTCTAGGG + Intergenic
1189885425 X:45539362-45539384 ATGCATAATAATCATATCAATGG - Intergenic
1190853921 X:54274426-54274448 GTCCATAATAATAAGCGTGAAGG - Intronic
1195120530 X:101746081-101746103 ATGCATCATATTAATCTAGAAGG + Intergenic
1195375343 X:104221316-104221338 ATGCATTTTAATAAGCTCCCAGG + Intergenic