ID: 1127752622

View in Genome Browser
Species Human (GRCh38)
Location 15:62060584-62060606
Sequence GGCCCTCTAGAGGCCGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127752615_1127752622 4 Left 1127752615 15:62060557-62060579 CCGAGGCTTTGTAGGCGCCGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1127752622 15:62060584-62060606 GGCCCTCTAGAGGCCGACGGAGG 0: 1
1: 0
2: 0
3: 1
4: 73
1127752611_1127752622 17 Left 1127752611 15:62060544-62060566 CCCAGCTGTGATCCCGAGGCTTT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1127752622 15:62060584-62060606 GGCCCTCTAGAGGCCGACGGAGG 0: 1
1: 0
2: 0
3: 1
4: 73
1127752614_1127752622 5 Left 1127752614 15:62060556-62060578 CCCGAGGCTTTGTAGGCGCCGCA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1127752622 15:62060584-62060606 GGCCCTCTAGAGGCCGACGGAGG 0: 1
1: 0
2: 0
3: 1
4: 73
1127752612_1127752622 16 Left 1127752612 15:62060545-62060567 CCAGCTGTGATCCCGAGGCTTTG 0: 1
1: 0
2: 0
3: 6
4: 153
Right 1127752622 15:62060584-62060606 GGCCCTCTAGAGGCCGACGGAGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127752622 Original CRISPR GGCCCTCTAGAGGCCGACGG AGG Intergenic
900100340 1:959791-959813 GGCCCTCTGGGTGCCGACCGCGG + Intergenic
901064919 1:6490044-6490066 AGCCCTCTCGAGGCCGGCAGGGG - Intronic
901231960 1:7646437-7646459 GGCCCTGTTGAGGCGGATGGAGG + Intronic
901602061 1:10430327-10430349 GGCTGGCTGGAGGCCGACGGCGG + Exonic
901987840 1:13090383-13090405 GGCCCTGGAGAGGCAGACAGTGG + Intergenic
901993972 1:13136384-13136406 GGCCCTGGAGAGGCAGACAGTGG - Intergenic
905916648 1:41689282-41689304 TGCCCTGTGGAGGCCGAGGGAGG - Intronic
917657172 1:177138004-177138026 GGCCCTCTAGAGGCTGGAAGAGG + Intronic
922674258 1:227541373-227541395 GTCCCTCAAGAGGCCTAGGGTGG + Intergenic
1064011941 10:11742581-11742603 GGCCCGCAAGACGGCGACGGCGG - Exonic
1070369683 10:75770655-75770677 GGCCTTGTGGAGGCCGAGGGTGG + Intronic
1070646036 10:78203174-78203196 GGCTCCCTAGAGGCCCACTGTGG - Intergenic
1071893057 10:90033314-90033336 GGACGTCTAGAGGCAGAGGGAGG + Intergenic
1074744797 10:116521607-116521629 GGCCCTCTAGTGGAAGAAGGTGG + Intergenic
1083196675 11:61092391-61092413 GGCCCAGTAGAGGCTGAAGGTGG - Intergenic
1084169516 11:67393951-67393973 GGCTCTTTAAAGGCAGACGGTGG + Intronic
1084601287 11:70147377-70147399 GACCCTCAGGAGGCAGACGGTGG - Intronic
1085513712 11:77100466-77100488 GACCTTCTGGAGGCCGAAGGTGG - Intronic
1090198745 11:124839331-124839353 GGCCGTGGAGAGGCCGGCGGCGG - Intergenic
1091998544 12:5014927-5014949 GGACCTGTAGAGGCAGAGGGCGG + Intergenic
1092752599 12:11732693-11732715 GGTCCTCTAGAGGCAGAAGGAGG - Intronic
1096536114 12:52275901-52275923 GGCCATCCAGTGGCTGACGGTGG + Exonic
1102341453 12:112125383-112125405 GGCTCCCTGGAGGCCCACGGGGG - Intergenic
1110607618 13:77451047-77451069 GGCCCTGTAGAGGCTGGCTGTGG - Intergenic
1116441823 14:44962628-44962650 GGCCCTCTTGATGCCCTCGGAGG + Exonic
1119438318 14:74612067-74612089 GGCCCTGAAGCGGCCGACTGGGG + Exonic
1119549376 14:75497250-75497272 GGACCTCCAGAGGCCCAGGGTGG - Intergenic
1121800623 14:96771068-96771090 GACCCTCAAGAGGCTGATGGAGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1127752622 15:62060584-62060606 GGCCCTCTAGAGGCCGACGGAGG + Intergenic
1139890691 16:70251677-70251699 GGCCCGCGACAGGCCGAGGGCGG - Exonic
1142403557 16:89873679-89873701 GGCCCTCCGGAGGCTGAGGGGGG + Exonic
1146398769 17:32487685-32487707 GGCCGTATAGTGGCCCACGGTGG - Exonic
1151568760 17:74915636-74915658 GGCCCTCCAGAGGCCCAGAGGGG - Intergenic
1152517441 17:80834082-80834104 GGCCCTCTCGGGGCCGTGGGTGG - Intronic
1157797880 18:50592173-50592195 GGAACTCTAGAGGCTCACGGAGG + Intronic
1161396911 19:4049534-4049556 TGCCCTCTCGAGGCTGGCGGCGG + Intronic
1162346311 19:10119932-10119954 GCCCCTCTAGGCGGCGACGGCGG - Intergenic
1165150729 19:33758713-33758735 GGCCCTCCAGGGGCAGACGTGGG - Intronic
1166803008 19:45469513-45469535 GCGCCTCTAGAGGCAGAGGGAGG + Intronic
1167472086 19:49680871-49680893 CGCCCTCTAGTGACCGGCGGTGG + Intronic
1167991705 19:53366100-53366122 TGCGCTCTAGGGGCCGACGAGGG - Intronic
938375315 2:130801446-130801468 GGCCCTCCAGGGGCTTACGGAGG + Intergenic
938453795 2:131445420-131445442 GGCCCTCTGGGTGCGGACGGCGG + Intergenic
947432988 2:230046719-230046741 AGGCCTGTACAGGCCGACGGGGG + Exonic
947674069 2:231961669-231961691 GGCGTTCTAGAGAGCGACGGTGG - Exonic
1168757214 20:325888-325910 GGGCCGCTAGACGCCGCCGGGGG - Exonic
1172487048 20:35304645-35304667 GGCCCACTAGAGGACAACAGAGG - Intronic
1175215375 20:57389592-57389614 TGCCCCCTAGAGGCCGGGGGAGG - Intergenic
1183154739 22:36066291-36066313 CGCCCTCTAGAGGACGTCAGGGG - Intergenic
1184111778 22:42399709-42399731 AGCCCTCTGGAGGCAGAGGGAGG + Intronic
954618868 3:51984466-51984488 GGCCCTCCAGAAGCCCACTGGGG + Intronic
954782678 3:53072836-53072858 TGCCCTCTAGTGGCTGCCGGCGG + Intronic
961446211 3:126982983-126983005 CGCCCTCTGGAGGCCGCCGCCGG + Intergenic
964630242 3:158802195-158802217 GGCCCTGACGAGGCCGACAGAGG + Exonic
973221579 4:47732673-47732695 GGCCCTCAAGAGGCTGAGGCAGG - Intronic
980935847 4:139225027-139225049 GGCACTCTAGAGGCTGAGGTAGG + Intergenic
982973724 4:162024762-162024784 GTCCCTCTAGAGGCTGAGGTTGG - Intronic
983877828 4:172897285-172897307 GGCCCTCTAGAGACCTGCTGTGG + Intronic
1006293983 6:33161707-33161729 GGCCGTCTAGACGCCCACGTGGG + Intergenic
1008887132 6:56443940-56443962 GGCCCCCAAGAGGCCCAGGGAGG - Intergenic
1019492887 7:1323304-1323326 GCCCCACGAGAGGCCGGCGGAGG - Intergenic
1032540487 7:132699087-132699109 GCCTCTGTAGAGGCAGACGGAGG + Intronic
1033600544 7:142885611-142885633 GGACCTCTACAGGGAGACGGTGG - Exonic
1035642365 8:1193847-1193869 GAGGCTCTAGAGGCCGACGCTGG - Intergenic
1035748388 8:1978149-1978171 GGGCCTGTAGAGGGCGGCGGAGG - Intronic
1042320203 8:67467754-67467776 GGACTTCTGGAGGCCGAGGGGGG + Intronic
1046767907 8:118090306-118090328 GGCACTCCAGAGGCCGAGGTGGG + Intronic
1048889703 8:138936356-138936378 GGCCCTCTGGCGGGCGGCGGGGG + Intergenic
1048928913 8:139295384-139295406 GGCCCACTGGAGGCCGAGGTGGG + Intergenic
1189847287 X:45149239-45149261 GACCCTCCAGAGTCCCACGGAGG - Exonic
1191570249 X:62605666-62605688 GGCCGTTTAGAGGCCTTCGGTGG + Intergenic
1191867906 X:65720489-65720511 GGCCCTCTTGAGGCCAAGGCAGG + Intronic
1196795073 X:119495788-119495810 AGCCCTCTAGAGGCAGAGTGGGG - Intergenic
1200078948 X:153566121-153566143 GGCCCTCTGGAGGCTGCTGGGGG - Intronic