ID: 1127753515

View in Genome Browser
Species Human (GRCh38)
Location 15:62068272-62068294
Sequence GGGGGCCCGGGCCGGGGACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1021
Summary {0: 2, 1: 0, 2: 11, 3: 79, 4: 929}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753515_1127753534 23 Left 1127753515 15:62068272-62068294 CCCAGTCCCCGGCCCGGGCCCCC 0: 2
1: 0
2: 11
3: 79
4: 929
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753515_1127753527 1 Left 1127753515 15:62068272-62068294 CCCAGTCCCCGGCCCGGGCCCCC 0: 2
1: 0
2: 11
3: 79
4: 929
Right 1127753527 15:62068296-62068318 CCACGAGCCCGCCGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
1127753515_1127753536 26 Left 1127753515 15:62068272-62068294 CCCAGTCCCCGGCCCGGGCCCCC 0: 2
1: 0
2: 11
3: 79
4: 929
Right 1127753536 15:62068321-62068343 CCCGTTTCCCGAGCGCCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 74
1127753515_1127753528 2 Left 1127753515 15:62068272-62068294 CCCAGTCCCCGGCCCGGGCCCCC 0: 2
1: 0
2: 11
3: 79
4: 929
Right 1127753528 15:62068297-62068319 CACGAGCCCGCCGTCGTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753515 Original CRISPR GGGGGCCCGGGCCGGGGACT GGG (reversed) Exonic