ID: 1127753516

View in Genome Browser
Species Human (GRCh38)
Location 15:62068273-62068295
Sequence AGGGGGCCCGGGCCGGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 0, 2: 5, 3: 91, 4: 934}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753516_1127753534 22 Left 1127753516 15:62068273-62068295 CCAGTCCCCGGCCCGGGCCCCCT 0: 1
1: 0
2: 5
3: 91
4: 934
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753516_1127753536 25 Left 1127753516 15:62068273-62068295 CCAGTCCCCGGCCCGGGCCCCCT 0: 1
1: 0
2: 5
3: 91
4: 934
Right 1127753536 15:62068321-62068343 CCCGTTTCCCGAGCGCCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 74
1127753516_1127753528 1 Left 1127753516 15:62068273-62068295 CCAGTCCCCGGCCCGGGCCCCCT 0: 1
1: 0
2: 5
3: 91
4: 934
Right 1127753528 15:62068297-62068319 CACGAGCCCGCCGTCGTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1127753516_1127753527 0 Left 1127753516 15:62068273-62068295 CCAGTCCCCGGCCCGGGCCCCCT 0: 1
1: 0
2: 5
3: 91
4: 934
Right 1127753527 15:62068296-62068318 CCACGAGCCCGCCGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753516 Original CRISPR AGGGGGCCCGGGCCGGGGAC TGG (reversed) Exonic