ID: 1127753517

View in Genome Browser
Species Human (GRCh38)
Location 15:62068278-62068300
Sequence CGTGGAGGGGGCCCGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 761
Summary {0: 1, 1: 1, 2: 8, 3: 82, 4: 669}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753517_1127753540 27 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753540 15:62068328-62068350 CCCGAGCGCCTGGAGGCCGAGGG 0: 1
1: 0
2: 1
3: 9
4: 150
1127753517_1127753527 -5 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753527 15:62068296-62068318 CCACGAGCCCGCCGTCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
1127753517_1127753536 20 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753536 15:62068321-62068343 CCCGTTTCCCGAGCGCCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 74
1127753517_1127753534 17 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753517_1127753528 -4 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753528 15:62068297-62068319 CACGAGCCCGCCGTCGTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1127753517_1127753538 26 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753538 15:62068327-62068349 TCCCGAGCGCCTGGAGGCCGAGG 0: 1
1: 0
2: 2
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753517 Original CRISPR CGTGGAGGGGGCCCGGGCCG GGG (reversed) Exonic