ID: 1127753520

View in Genome Browser
Species Human (GRCh38)
Location 15:62068284-62068306
Sequence CGGGCTCGTGGAGGGGGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 342}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753520_1127753528 -10 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753528 15:62068297-62068319 CACGAGCCCGCCGTCGTCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1127753520_1127753538 20 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753538 15:62068327-62068349 TCCCGAGCGCCTGGAGGCCGAGG 0: 1
1: 0
2: 2
3: 17
4: 179
1127753520_1127753536 14 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753536 15:62068321-62068343 CCCGTTTCCCGAGCGCCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 74
1127753520_1127753534 11 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753520_1127753543 29 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753543 15:62068336-62068358 CCTGGAGGCCGAGGGCACCGTGG 0: 1
1: 1
2: 2
3: 36
4: 359
1127753520_1127753540 21 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753540 15:62068328-62068350 CCCGAGCGCCTGGAGGCCGAGGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753520 Original CRISPR CGGGCTCGTGGAGGGGGCCC GGG (reversed) Exonic