ID: 1127753524

View in Genome Browser
Species Human (GRCh38)
Location 15:62068292-62068314
Sequence GACGACGGCGGGCTCGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753524_1127753544 27 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753544 15:62068342-62068364 GGCCGAGGGCACCGTGGCTCTGG 0: 1
1: 1
2: 2
3: 24
4: 225
1127753524_1127753540 13 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753540 15:62068328-62068350 CCCGAGCGCCTGGAGGCCGAGGG 0: 1
1: 0
2: 1
3: 9
4: 150
1127753524_1127753543 21 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753543 15:62068336-62068358 CCTGGAGGCCGAGGGCACCGTGG 0: 1
1: 1
2: 2
3: 36
4: 359
1127753524_1127753534 3 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753524_1127753545 28 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753545 15:62068343-62068365 GCCGAGGGCACCGTGGCTCTGGG 0: 1
1: 1
2: 1
3: 11
4: 151
1127753524_1127753538 12 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753538 15:62068327-62068349 TCCCGAGCGCCTGGAGGCCGAGG 0: 1
1: 0
2: 2
3: 17
4: 179
1127753524_1127753536 6 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753536 15:62068321-62068343 CCCGTTTCCCGAGCGCCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753524 Original CRISPR GACGACGGCGGGCTCGTGGA GGG (reversed) Exonic