ID: 1127753529

View in Genome Browser
Species Human (GRCh38)
Location 15:62068303-62068325
Sequence ACGGGACCCGGGACGACGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 49}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753529_1127753544 16 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753544 15:62068342-62068364 GGCCGAGGGCACCGTGGCTCTGG 0: 1
1: 1
2: 2
3: 24
4: 225
1127753529_1127753547 26 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753547 15:62068352-62068374 ACCGTGGCTCTGGGCCGCGCCGG 0: 2
1: 0
2: 1
3: 13
4: 97
1127753529_1127753536 -5 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753536 15:62068321-62068343 CCCGTTTCCCGAGCGCCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 74
1127753529_1127753538 1 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753538 15:62068327-62068349 TCCCGAGCGCCTGGAGGCCGAGG 0: 1
1: 0
2: 2
3: 17
4: 179
1127753529_1127753534 -8 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753529_1127753543 10 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753543 15:62068336-62068358 CCTGGAGGCCGAGGGCACCGTGG 0: 1
1: 1
2: 2
3: 36
4: 359
1127753529_1127753545 17 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753545 15:62068343-62068365 GCCGAGGGCACCGTGGCTCTGGG 0: 1
1: 1
2: 1
3: 11
4: 151
1127753529_1127753540 2 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753540 15:62068328-62068350 CCCGAGCGCCTGGAGGCCGAGGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753529 Original CRISPR ACGGGACCCGGGACGACGGC GGG (reversed) Exonic