ID: 1127753534

View in Genome Browser
Species Human (GRCh38)
Location 15:62068318-62068340
Sequence GGTCCCGTTTCCCGAGCGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753530_1127753534 -9 Left 1127753530 15:62068304-62068326 CCGCCGTCGTCCCGGGTCCCGTT 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753521_1127753534 10 Left 1127753521 15:62068285-62068307 CCGGGCCCCCTCCACGAGCCCGC 0: 1
1: 1
2: 0
3: 31
4: 378
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753518_1127753534 16 Left 1127753518 15:62068279-62068301 CCCGGCCCGGGCCCCCTCCACGA 0: 1
1: 1
2: 3
3: 23
4: 348
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753522_1127753534 5 Left 1127753522 15:62068290-62068312 CCCCCTCCACGAGCCCGCCGTCG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753515_1127753534 23 Left 1127753515 15:62068272-62068294 CCCAGTCCCCGGCCCGGGCCCCC 0: 2
1: 0
2: 11
3: 79
4: 929
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753519_1127753534 15 Left 1127753519 15:62068280-62068302 CCGGCCCGGGCCCCCTCCACGAG 0: 1
1: 1
2: 0
3: 18
4: 303
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753526_1127753534 -1 Left 1127753526 15:62068296-62068318 CCACGAGCCCGCCGTCGTCCCGG 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753516_1127753534 22 Left 1127753516 15:62068273-62068295 CCAGTCCCCGGCCCGGGCCCCCT 0: 1
1: 0
2: 5
3: 91
4: 934
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753529_1127753534 -8 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753524_1127753534 3 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753523_1127753534 4 Left 1127753523 15:62068291-62068313 CCCCTCCACGAGCCCGCCGTCGT 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753520_1127753534 11 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753525_1127753534 2 Left 1127753525 15:62068293-62068315 CCTCCACGAGCCCGCCGTCGTCC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753517_1127753534 17 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753534 Original CRISPR GGTCCCGTTTCCCGAGCGCC TGG Exonic
907447467 1:54518030-54518052 GGTCCCGTCCCCCGACTGCCAGG - Intergenic
920322157 1:205132419-205132441 GGGCCCGTTTCCCCACGGCCTGG - Intergenic
922335841 1:224617496-224617518 CGTCCCGGGTCCCGGGCGCCGGG + Intronic
922932892 1:229403894-229403916 GTTCCCCTTTCCCGAGGGGCAGG - Intergenic
1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG + Intergenic
1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG + Intergenic
1069651704 10:70053717-70053739 GGTTCCCTTTCCGGGGCGCCCGG + Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1083838809 11:65291112-65291134 TGTCCCTTTTCCCCAGTGCCAGG + Intronic
1089574587 11:119432433-119432455 GGTCCCTTCTCCCGAGGGGCTGG + Intergenic
1096771091 12:53936583-53936605 GGACCCGTTTTCCGCGGGCCAGG - Intergenic
1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG + Intronic
1113917736 13:113884304-113884326 GGTCCGGGGTCCCGAGCCCCGGG + Intergenic
1127713401 15:61624041-61624063 GGCACCGTTTCCCGAGCCCTTGG - Intergenic
1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG + Exonic
1127763526 15:62164273-62164295 GGCCCCGCTTCCTGAGCGCCTGG - Exonic
1129177389 15:73849710-73849732 GGTTCCTTTTCCAGAGGGCCTGG - Intergenic
1143585743 17:7849333-7849355 GGTCCAGGTTCCCCAGCACCCGG - Exonic
1148337719 17:46852305-46852327 GGTCGCATTTCCCCAGCGCACGG - Intronic
1148690550 17:49524632-49524654 GGTCTCGTTTCCCCCGTGCCAGG + Intergenic
1153027890 18:687809-687831 GGTCCCAGTTCCCAAGAGCCAGG - Intronic
1161105549 19:2442017-2442039 AGACCCGTTTCCTAAGCGCCAGG + Intronic
1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG + Intronic
1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG + Intronic
1161735943 19:5992076-5992098 AGGCCAGTTTCCCGAGTGCCAGG - Intergenic
1162731297 19:12720701-12720723 GGTCCCATTTCCAGAGCTGCGGG - Intronic
1167721965 19:51185485-51185507 GGTCAGGTTTCCCGGGCGGCCGG - Intergenic
932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG + Intergenic
937316859 2:120937201-120937223 GGGCCCGTATCCCCAGTGCCTGG - Intronic
1172547258 20:35771837-35771859 GGGCCTGTTTCCCGCGCGTCAGG + Intergenic
1175257363 20:57655418-57655440 GCTACCGTTTCCCCAGTGCCAGG + Intronic
1179263607 21:39781605-39781627 GTTCCCGTTTCCCCACAGCCTGG + Intronic
1183318089 22:37147939-37147961 GGTCCCCTTGCCCCAGGGCCAGG - Intronic
1185033874 22:48460736-48460758 GGTCGCCTTTCCCAAGGGCCAGG + Intergenic
951678955 3:25274542-25274564 GGTCCCCTTTCCAGGGAGCCAGG - Intronic
954154771 3:48679310-48679332 GGGCCCATTGCCCGAGGGCCTGG - Intronic
968213517 3:196868487-196868509 GGACCCTTTTCCAGAGAGCCCGG + Intronic
968588991 4:1448466-1448488 AGCCCCTTTTCCCGAGCTCCAGG + Intergenic
1002896198 6:1381964-1381986 GGCCGCGATTCCCGAGAGCCTGG + Intergenic
1032636306 7:133712939-133712961 TGTCCCCTTTCCCTAGCCCCTGG - Intronic
1036708514 8:11062201-11062223 GGTCCACTTCCCCCAGCGCCTGG - Intronic
1039895355 8:41713212-41713234 TATCCTGTTTCCCGTGCGCCTGG + Intronic
1039996837 8:42541613-42541635 GTAACCGTTTCCCGCGCGCCCGG + Intronic
1056936701 9:90920059-90920081 CGACCCGTTTCCCGAGAGCTTGG - Intergenic
1057054467 9:91950064-91950086 GGACCCGTTTGCGAAGCGCCAGG - Exonic
1060832074 9:126723070-126723092 GGTCCCGATCCCCGAGTGCCTGG - Intergenic
1061783311 9:133008292-133008314 GACCCCGCTTCCCCAGCGCCTGG - Intergenic
1190216558 X:48482737-48482759 GGACACGTTTCCCCAGCCCCTGG + Exonic