ID: 1127753534

View in Genome Browser
Species Human (GRCh38)
Location 15:62068318-62068340
Sequence GGTCCCGTTTCCCGAGCGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753521_1127753534 10 Left 1127753521 15:62068285-62068307 CCGGGCCCCCTCCACGAGCCCGC 0: 1
1: 1
2: 0
3: 31
4: 378
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753517_1127753534 17 Left 1127753517 15:62068278-62068300 CCCCGGCCCGGGCCCCCTCCACG 0: 1
1: 1
2: 8
3: 82
4: 669
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753522_1127753534 5 Left 1127753522 15:62068290-62068312 CCCCCTCCACGAGCCCGCCGTCG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753519_1127753534 15 Left 1127753519 15:62068280-62068302 CCGGCCCGGGCCCCCTCCACGAG 0: 1
1: 1
2: 0
3: 18
4: 303
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753518_1127753534 16 Left 1127753518 15:62068279-62068301 CCCGGCCCGGGCCCCCTCCACGA 0: 1
1: 1
2: 3
3: 23
4: 348
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753515_1127753534 23 Left 1127753515 15:62068272-62068294 CCCAGTCCCCGGCCCGGGCCCCC 0: 2
1: 0
2: 11
3: 79
4: 929
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753525_1127753534 2 Left 1127753525 15:62068293-62068315 CCTCCACGAGCCCGCCGTCGTCC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753516_1127753534 22 Left 1127753516 15:62068273-62068295 CCAGTCCCCGGCCCGGGCCCCCT 0: 1
1: 0
2: 5
3: 91
4: 934
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753524_1127753534 3 Left 1127753524 15:62068292-62068314 CCCTCCACGAGCCCGCCGTCGTC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753530_1127753534 -9 Left 1127753530 15:62068304-62068326 CCGCCGTCGTCCCGGGTCCCGTT 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753526_1127753534 -1 Left 1127753526 15:62068296-62068318 CCACGAGCCCGCCGTCGTCCCGG 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753523_1127753534 4 Left 1127753523 15:62068291-62068313 CCCCTCCACGAGCCCGCCGTCGT 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753529_1127753534 -8 Left 1127753529 15:62068303-62068325 CCCGCCGTCGTCCCGGGTCCCGT 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1127753520_1127753534 11 Left 1127753520 15:62068284-62068306 CCCGGGCCCCCTCCACGAGCCCG 0: 1
1: 1
2: 2
3: 23
4: 342
Right 1127753534 15:62068318-62068340 GGTCCCGTTTCCCGAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753534 Original CRISPR GGTCCCGTTTCCCGAGCGCC TGG Exonic