ID: 1127753679

View in Genome Browser
Species Human (GRCh38)
Location 15:62068966-62068988
Sequence CATATGTACCACACACGCCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127753676_1127753679 2 Left 1127753676 15:62068941-62068963 CCAATATAGACAGCCATTTGCAT 0: 1
1: 0
2: 0
3: 17
4: 125
Right 1127753679 15:62068966-62068988 CATATGTACCACACACGCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 54
1127753675_1127753679 3 Left 1127753675 15:62068940-62068962 CCCAATATAGACAGCCATTTGCA 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1127753679 15:62068966-62068988 CATATGTACCACACACGCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127753679 Original CRISPR CATATGTACCACACACGCCT AGG Exonic
906286948 1:44593847-44593869 CAAATGATCCACCCACGCCTTGG - Intronic
906783662 1:48595461-48595483 CATTTGTGACACACACCCCTTGG - Intronic
913597607 1:120393769-120393791 CAGATCGACCACACAAGCCTTGG - Intergenic
914089723 1:144485545-144485567 CAGATCGACCACACAAGCCTTGG + Intergenic
914512440 1:148345819-148345841 CAGATCGACCACACAAGCCTTGG + Intergenic
914593222 1:149124460-149124482 CAGATCGACCACACAAGCCTTGG + Intergenic
914939931 1:152013801-152013823 CAAATCGACCACACAAGCCTTGG - Intergenic
917415994 1:174809776-174809798 CAGATGTACCACACATCCCTAGG - Intronic
918221106 1:182437231-182437253 CAGATGTACCACTGACACCTAGG - Intergenic
1069196616 10:65558761-65558783 CTTATGTACCACATAGTCCTAGG - Intergenic
1070599293 10:77854478-77854500 TCTATGCACCACACACACCTGGG + Intronic
1080307126 11:30848744-30848766 CAAATGTCGCACACATGCCTGGG - Intronic
1086539752 11:87894669-87894691 CATATGTCCCACACACCAGTAGG - Intergenic
1089854625 11:121532275-121532297 CATCTGTTCCACACAATCCTAGG - Intronic
1095168098 12:38998458-38998480 AGAATGTACCACACACACCTAGG - Intergenic
1112104063 13:96221245-96221267 CATATGTACCCCACACAAATAGG - Intronic
1114225374 14:20733095-20733117 CATATGTTCCACCCAGGCTTTGG + Intronic
1125190497 15:36986959-36986981 CATACCTTCCACACACCCCTTGG - Intronic
1127753679 15:62068966-62068988 CATATGTACCACACACGCCTAGG + Exonic
1130284034 15:82540733-82540755 CATCTCTTCCACACACGCCAGGG + Intronic
1139416143 16:66812439-66812461 CAGAATTACCACATACGCCTAGG - Intronic
1152997700 18:423681-423703 CATACTGACCACACACGCCCAGG + Intronic
1157682879 18:49620668-49620690 CATCTGTACAACAAACCCCTGGG - Intergenic
936645703 2:114367592-114367614 CATCTTTACCACAAATGCCTTGG - Intergenic
936963193 2:118098585-118098607 CAAATGCACAACACACGCCAGGG - Intronic
946964434 2:225022737-225022759 CATATGCACAACAAATGCCTGGG + Intronic
1172459158 20:35102506-35102528 CAGATGTATCCCCCACGCCTGGG - Intergenic
1178374551 21:32056156-32056178 CATGTGTACCCCCCACGCCTTGG - Intergenic
1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG + Intergenic
952619825 3:35324294-35324316 AATATGTACAACAAACCCCTGGG + Intergenic
957342481 3:78918762-78918784 CATATGTCCCACATACTTCTAGG + Intronic
958156357 3:89761150-89761172 CATTTTTACCCCACACCCCTCGG - Intergenic
959475274 3:106803366-106803388 CACATGTAGCCCACAGGCCTTGG - Intergenic
959889833 3:111542127-111542149 GAACTCTACCACACACGCCTGGG - Exonic
961751320 3:129096471-129096493 TGTGTGTACCACACAAGCCTGGG + Intronic
969869526 4:10095970-10095992 CATTTGTACCCAACACTCCTGGG + Intronic
976449698 4:85174229-85174251 CATATGAAAAACACACTCCTAGG - Intergenic
988398183 5:30724568-30724590 CATATCTATCACACAGACCTTGG - Intergenic
991058349 5:62343830-62343852 CATGTGTACCAGAAACTCCTAGG - Intronic
991998472 5:72412137-72412159 CATTTGTACCGCAGACACCTCGG + Intergenic
999658122 5:153830361-153830383 CATATGTACCACCCAAGCATGGG + Intergenic
1001098247 5:168792970-168792992 CATATATACCTCACACACATAGG - Intronic
1001847551 5:174935518-174935540 CTCATGGACCACACAGGCCTGGG + Intergenic
1003958996 6:11191796-11191818 CATATGTTCAAAACAAGCCTGGG + Intronic
1005011959 6:21344306-21344328 AATATGTACAACAAACCCCTGGG + Intergenic
1006741291 6:36310957-36310979 CAAATGTCCCACACAGGCCTGGG - Intergenic
1010495377 6:76528681-76528703 AATATGTACCACATACACCATGG - Intergenic
1012053091 6:94368731-94368753 CAGATGTACCACTCAGGTCTTGG - Intergenic
1018851576 6:167644272-167644294 CATGTGTAGGACACACGCATGGG - Intergenic
1019658170 7:2209140-2209162 CTTATGTGTCACACAGGCCTGGG - Intronic
1034925183 7:155115479-155115501 GATCTGTCCCACCCACGCCTGGG - Intergenic
1039405791 8:37311437-37311459 CATTTGTACCACACTAGCCCAGG - Intergenic
1039735010 8:40322460-40322482 CATATGTACCATGTAGGCCTTGG - Intergenic
1046793229 8:118343712-118343734 CATCTCTACCACAGACCCCTTGG + Intronic
1050438283 9:5631749-5631771 CATATGTATCCCACTCACCTAGG - Intronic
1061218325 9:129234865-129234887 CATCTGGGCCACACAAGCCTTGG + Intergenic
1062560720 9:137140603-137140625 CTCATGTGCCACACACGGCTTGG + Intronic
1196614260 X:117749676-117749698 TAAATGCACCACACACGCTTCGG + Intergenic
1201585993 Y:15561717-15561739 CAGATTTCCCACACACACCTAGG - Intergenic