ID: 1127755204

View in Genome Browser
Species Human (GRCh38)
Location 15:62085430-62085452
Sequence GAAGTTGCTCTGATTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127755203_1127755204 -2 Left 1127755203 15:62085409-62085431 CCACACAATAATCTTAAAGATGA No data
Right 1127755204 15:62085430-62085452 GAAGTTGCTCTGATTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127755204 Original CRISPR GAAGTTGCTCTGATTGATGA TGG Intergenic
No off target data available for this crispr