ID: 1127756687

View in Genome Browser
Species Human (GRCh38)
Location 15:62099300-62099322
Sequence GTGTCAGTGGGACTCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127756687_1127756690 9 Left 1127756687 15:62099300-62099322 CCTCTGAGGAGTCCCACTGACAC No data
Right 1127756690 15:62099332-62099354 TCCGACTGAGTCATTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127756687 Original CRISPR GTGTCAGTGGGACTCCTCAG AGG (reversed) Intergenic
No off target data available for this crispr