ID: 1127758324

View in Genome Browser
Species Human (GRCh38)
Location 15:62113950-62113972
Sequence CTGCCCTGAGGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127758324_1127758334 11 Left 1127758324 15:62113950-62113972 CCCTCCACCTGCCCTCAGGGCAG No data
Right 1127758334 15:62113984-62114006 GCGTCTCCACAACCTGGCACTGG No data
1127758324_1127758331 5 Left 1127758324 15:62113950-62113972 CCCTCCACCTGCCCTCAGGGCAG No data
Right 1127758331 15:62113978-62114000 AACCCTGCGTCTCCACAACCTGG No data
1127758324_1127758335 16 Left 1127758324 15:62113950-62113972 CCCTCCACCTGCCCTCAGGGCAG No data
Right 1127758335 15:62113989-62114011 TCCACAACCTGGCACTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127758324 Original CRISPR CTGCCCTGAGGGCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr