ID: 1127762634

View in Genome Browser
Species Human (GRCh38)
Location 15:62153962-62153984
Sequence AGGTAGAAGAAAAATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127762627_1127762634 9 Left 1127762627 15:62153930-62153952 CCTTTGAACATCTTCTTATGGAA No data
Right 1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG No data
1127762626_1127762634 10 Left 1127762626 15:62153929-62153951 CCCTTTGAACATCTTCTTATGGA No data
Right 1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127762634 Original CRISPR AGGTAGAAGAAAAATGGGGA AGG Intergenic
No off target data available for this crispr