ID: 1127763526

View in Genome Browser
Species Human (GRCh38)
Location 15:62164273-62164295
Sequence GGCCCCGCTTCCTGAGCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 214}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127763526_1127763529 -8 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763529 15:62164288-62164310 GCGGGGCCCTGGATGACAGCGGG 0: 1
1: 0
2: 1
3: 23
4: 216
1127763526_1127763541 17 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763541 15:62164313-62164335 CGAGGAGGGGGCCCGGGCCGGGG 0: 1
1: 1
2: 10
3: 85
4: 855
1127763526_1127763532 -1 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763532 15:62164295-62164317 CCTGGATGACAGCGGGCTCGAGG 0: 1
1: 0
2: 1
3: 6
4: 91
1127763526_1127763535 4 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763535 15:62164300-62164322 ATGACAGCGGGCTCGAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 70
1127763526_1127763542 23 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763542 15:62164319-62164341 GGGGGCCCGGGCCGGGGACTCGG 0: 2
1: 0
2: 11
3: 79
4: 929
1127763526_1127763537 10 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763537 15:62164306-62164328 GCGGGCTCGAGGAGGGGGCCCGG 0: 1
1: 1
2: 0
3: 43
4: 511
1127763526_1127763528 -9 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763528 15:62164287-62164309 AGCGGGGCCCTGGATGACAGCGG 0: 1
1: 0
2: 1
3: 17
4: 220
1127763526_1127763538 11 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763538 15:62164307-62164329 CGGGCTCGAGGAGGGGGCCCGGG 0: 1
1: 1
2: 2
3: 38
4: 383
1127763526_1127763539 15 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763539 15:62164311-62164333 CTCGAGGAGGGGGCCCGGGCCGG 0: 1
1: 1
2: 1
3: 29
4: 378
1127763526_1127763536 5 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763536 15:62164301-62164323 TGACAGCGGGCTCGAGGAGGGGG 0: 1
1: 0
2: 1
3: 9
4: 128
1127763526_1127763533 2 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763533 15:62164298-62164320 GGATGACAGCGGGCTCGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 96
1127763526_1127763534 3 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763534 15:62164299-62164321 GATGACAGCGGGCTCGAGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 104
1127763526_1127763540 16 Left 1127763526 15:62164273-62164295 CCAGGCGCTCAGGAAGCGGGGCC 0: 1
1: 1
2: 1
3: 19
4: 214
Right 1127763540 15:62164312-62164334 TCGAGGAGGGGGCCCGGGCCGGG 0: 1
1: 1
2: 4
3: 46
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127763526 Original CRISPR GGCCCCGCTTCCTGAGCGCC TGG (reversed) Exonic