ID: 1127770139

View in Genome Browser
Species Human (GRCh38)
Location 15:62224302-62224324
Sequence CCTGCACCCCGCCACGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127770139_1127770155 28 Left 1127770139 15:62224302-62224324 CCTCCTCCGTGGCGGGGTGCAGG No data
Right 1127770155 15:62224353-62224375 CTGCCCTCCCCTGCCCTGCCTGG No data
1127770139_1127770145 -5 Left 1127770139 15:62224302-62224324 CCTCCTCCGTGGCGGGGTGCAGG No data
Right 1127770145 15:62224320-62224342 GCAGGGAGGAGCCCCAGCCGCGG No data
1127770139_1127770146 -4 Left 1127770139 15:62224302-62224324 CCTCCTCCGTGGCGGGGTGCAGG No data
Right 1127770146 15:62224321-62224343 CAGGGAGGAGCCCCAGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127770139 Original CRISPR CCTGCACCCCGCCACGGAGG AGG (reversed) Intergenic
No off target data available for this crispr