ID: 1127773073

View in Genome Browser
Species Human (GRCh38)
Location 15:62245871-62245893
Sequence CCTCTTCCTGCTCTTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127773067_1127773073 5 Left 1127773067 15:62245843-62245865 CCAGCATCCTCTCCTCTTGCTCC 0: 1
1: 5
2: 29
3: 195
4: 980
Right 1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773069_1127773073 -7 Left 1127773069 15:62245855-62245877 CCTCTTGCTCCAGCAACCTCTTC 0: 1
1: 4
2: 3
3: 38
4: 473
Right 1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773068_1127773073 -2 Left 1127773068 15:62245850-62245872 CCTCTCCTCTTGCTCCAGCAACC No data
Right 1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773066_1127773073 14 Left 1127773066 15:62245834-62245856 CCTCTTGCTCCAGCATCCTCTCC 0: 1
1: 4
2: 8
3: 92
4: 766
Right 1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773064_1127773073 26 Left 1127773064 15:62245822-62245844 CCAGCAGCCTCTCCTCTTGCTCC 0: 1
1: 12
2: 19
3: 151
4: 953
Right 1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773065_1127773073 19 Left 1127773065 15:62245829-62245851 CCTCTCCTCTTGCTCCAGCATCC 0: 1
1: 4
2: 14
3: 75
4: 676
Right 1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127773073 Original CRISPR CCTCTTCCTGCTCTTGGTTC AGG Intergenic
No off target data available for this crispr