ID: 1127773118

View in Genome Browser
Species Human (GRCh38)
Location 15:62246170-62246192
Sequence CCTCTTCCTGCTCTTCGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 2, 2: 4, 3: 28, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127773115_1127773118 7 Left 1127773115 15:62246140-62246162 CCTCTCGTCTTGTTCCAACAATC 0: 1
1: 0
2: 0
3: 1
4: 80
Right 1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG 0: 1
1: 2
2: 4
3: 28
4: 263
1127773114_1127773118 14 Left 1127773114 15:62246133-62246155 CCAACAACCTCTCGTCTTGTTCC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG 0: 1
1: 2
2: 4
3: 28
4: 263
1127773116_1127773118 -7 Left 1127773116 15:62246154-62246176 CCAACAATCTCAGCAACCTCTTC 0: 1
1: 0
2: 1
3: 24
4: 275
Right 1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG 0: 1
1: 2
2: 4
3: 28
4: 263
1127773113_1127773118 23 Left 1127773113 15:62246124-62246146 CCTCTTGCTCCAACAACCTCTCG 0: 1
1: 0
2: 3
3: 10
4: 155
Right 1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG 0: 1
1: 2
2: 4
3: 28
4: 263
1127773112_1127773118 28 Left 1127773112 15:62246119-62246141 CCTCTCCTCTTGCTCCAACAACC 0: 1
1: 4
2: 4
3: 25
4: 328
Right 1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG 0: 1
1: 2
2: 4
3: 28
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127773118 Original CRISPR CCTCTTCCTGCTCTTCGTTC AGG Intergenic
900919843 1:5663106-5663128 CCTCTAGCTGCTCATCCTTCAGG + Intergenic
901664159 1:10817060-10817082 CCTCTTCCTCCGGCTCGTTCTGG - Intergenic
901771744 1:11534058-11534080 CCAGTTCCTGCTCATCCTTCAGG - Intronic
902063689 1:13666300-13666322 CCCATTCCTGCTCTTCATTATGG - Intergenic
902275019 1:15333295-15333317 CCTCTTCCCGCTCCTCCTTCTGG - Intronic
902364211 1:15960527-15960549 CCTTTTCCTGGTCTTTTTTCAGG - Intronic
902431822 1:16369158-16369180 CATCTTCCTCCTCTTTGTCCTGG + Intronic
902684619 1:18067813-18067835 CCTGCTCCAGCTCTTGGTTCAGG + Intergenic
902789966 1:18761005-18761027 CCTCTTCCAGCCCTCCTTTCAGG - Intergenic
903669715 1:25028226-25028248 CCCCTTCTTCCTCTTCTTTCTGG + Intergenic
903750526 1:25617866-25617888 CCTCTTCCTCCTCTTCCTCTCGG + Exonic
904025050 1:27497350-27497372 CCTCCTCCTCCTCCTCCTTCAGG + Intergenic
905104646 1:35557303-35557325 CCTCTTCCTCCTCCTCCTCCGGG - Exonic
905890150 1:41513625-41513647 CCTCATCCTCGTCTTCGTCCAGG + Exonic
907451003 1:54545849-54545871 CCTCTTCTTGATCCCCGTTCAGG + Intronic
907544047 1:55243881-55243903 CCTCTTCCTCCCCTGGGTTCTGG + Intergenic
908234665 1:62137868-62137890 TCTCCTCCTTCTCTTCCTTCAGG + Intronic
909815289 1:79984945-79984967 CCTCTTCCAACCCTTTGTTCGGG - Intergenic
910280002 1:85489302-85489324 TCTCTGCCTTCTCTTCCTTCAGG - Intronic
910772335 1:90842699-90842721 CCTCTCCCTTCCCTTCGATCAGG + Intergenic
911885977 1:103300099-103300121 CATTTTCCTGCTCTTGATTCTGG - Intergenic
912253174 1:108031900-108031922 CCTTTTCATGCTCTCCCTTCTGG - Intergenic
913680570 1:121185139-121185161 CCTCTTCCTTTTCTTCCTCCCGG + Intronic
913691190 1:121281433-121281455 CCTCTTCCTCTTCTTCTTTTTGG + Intronic
914032401 1:143972781-143972803 CCTCTTCCTTTTCTTCCTCCCGG + Intergenic
914146353 1:144998548-144998570 CCTCTTCCTCTTCTTCTTTTTGG - Intronic
914157044 1:145095186-145095208 CCTCTTCCTTTTCTTCCTCCCGG - Intronic
916662685 1:166936684-166936706 CGTCTTCCTCTTCTTCGTCCTGG - Exonic
917705637 1:177631468-177631490 CCTCTTCCTTCTTTTACTTCAGG - Intergenic
917833566 1:178920429-178920451 CCTCTTGCTCCTCTTATTTCAGG + Intronic
919253804 1:195096209-195096231 CCTCTCCCTGCTCCTGGTGCCGG + Intergenic
920467879 1:206203665-206203687 CCTCTTCCTTTTCTTCCTCCCGG + Intronic
920478514 1:206299909-206299931 CCTCTTCCTCTTCTTCTTTTTGG + Intronic
920728882 1:208463801-208463823 CCTCTGCCTCCTCTTTTTTCAGG - Intergenic
923979447 1:239304612-239304634 CCCCTTTCTGCTCTTCCTTGGGG - Intergenic
924458058 1:244233960-244233982 CCTCTTCCTCCTCCTCCTTTGGG - Intergenic
1062763579 10:45509-45531 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1065084008 10:22156116-22156138 CCCCATCCTGCTCTTCACTCAGG + Intergenic
1073137096 10:101226114-101226136 CTTCTTGCCGCTCTTCGTGCCGG - Intergenic
1074199961 10:111225730-111225752 CCTCTTCCAGATCTTCCTTCAGG - Intergenic
1075093382 10:119455842-119455864 CCTCTGTCTGCTCTTCCTTCAGG + Intronic
1075796036 10:125120256-125120278 CATCTTCCTGCTCATCCTGCTGG - Intronic
1078189571 11:9081343-9081365 CCTCTTCCCTCTCTTCCCTCAGG + Intronic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1078931383 11:15914370-15914392 CCTCTTCCTCCTCTCGGTTAAGG - Intergenic
1079090095 11:17474920-17474942 CTTCATGCTGCTCTTCGTCCTGG - Exonic
1081469711 11:43358856-43358878 CCTCCTCCTGCTCCTCCTCCAGG + Intergenic
1084550877 11:69840960-69840982 CTTCTCTCTGCTCTTTGTTCAGG - Intergenic
1084872115 11:72105379-72105401 CCTCTGCCTGCTCTTCCCTGAGG - Intronic
1088418170 11:109612728-109612750 CCTCTTACTGTGCTTCCTTCAGG - Intergenic
1088440513 11:109865810-109865832 TCTCTTCCAGCTCTTCTTCCAGG + Intergenic
1088843368 11:113644840-113644862 CCTCTGCCTGGTCTCCATTCTGG + Intergenic
1089028330 11:115295275-115295297 CGTCCACCTGCTCTTCCTTCTGG + Intronic
1089128871 11:116196247-116196269 CTTTCTCCTGCTCTTCCTTCAGG - Intergenic
1089256706 11:117198046-117198068 CCTCTTCCTGCTTTTCCTGCAGG + Intergenic
1089290906 11:117437560-117437582 CCTCTTCCTCCTCTGCGCCCTGG - Intronic
1090480271 11:127061720-127061742 CCTCTCCCTGGGCTGCGTTCAGG - Intergenic
1090842580 11:130505479-130505501 CCTCTTTCTCCTCTCCTTTCAGG + Intergenic
1091005652 11:131950827-131950849 CTTCTTCCTCCACTTCCTTCTGG + Intronic
1091008568 11:131976894-131976916 CCTCATGCTGCTCTTCATTTAGG - Intronic
1091597329 12:1886855-1886877 CCTCTTCCTGCTCTTGTGTCGGG + Intronic
1092978794 12:13772664-13772686 CCTCTTCTTGCTCTTAGTTCAGG - Intronic
1096253728 12:50050698-50050720 CCTCTTCCTCCCCTTCCTGCAGG + Intergenic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1097170068 12:57107743-57107765 CCTCATCCTGATCTTCCTGCAGG - Exonic
1097361738 12:58665925-58665947 CCTCTTCTTTCTCTTGCTTCTGG + Intronic
1100693769 12:97067539-97067561 CTTCTTCCTGCTGTTCCTACAGG - Intergenic
1101800470 12:108017359-108017381 CCTCTTCTTCCTTTTCCTTCTGG - Intergenic
1102058622 12:109915438-109915460 CCTCTTCCTCCTCCTCCTGCTGG - Exonic
1102570162 12:113822646-113822668 CCTGTTCCTGCTCTCCCTCCAGG - Intronic
1103716769 12:122949656-122949678 TCTCCTCCTGCTGTTAGTTCAGG - Intronic
1104011725 12:124935488-124935510 CGTTTTCCTCCTCTTCGTCCTGG + Intergenic
1104419953 12:128627078-128627100 CCTCCTCCTCCTCTTCATTAAGG + Intronic
1104467457 12:129002535-129002557 CCTCTTTCTCCTGTTCTTTCAGG + Intergenic
1105042264 12:132969786-132969808 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1105284502 13:18993387-18993409 CCTCTTTCTGCTTTCTGTTCTGG - Intergenic
1106465605 13:30011766-30011788 TCTCTTCCAGCTCTTCGTGGAGG + Intergenic
1106870987 13:34020518-34020540 TCACTTCCTGCTCTGCGTTGGGG - Intergenic
1109606633 13:64705814-64705836 CCTTTTCCTTCTCTTAATTCTGG + Intergenic
1112148472 13:96729375-96729397 CATCATCCTGCTTTTAGTTCAGG - Intronic
1112256725 13:97840720-97840742 TCTCTTCCTGTTCTGCGTTTTGG - Intergenic
1113812042 13:113148920-113148942 CCTCCTCCTGCTCCGTGTTCCGG - Exonic
1114533358 14:23408759-23408781 CATCTTCCTGCTGTTAGTACTGG + Intergenic
1115398305 14:32933567-32933589 CCACTTCCTCCTCTTTCTTCCGG - Intergenic
1116233921 14:42253627-42253649 CCTCCTCCTCCTCCTTGTTCTGG - Intergenic
1118331392 14:64818491-64818513 CCACTCCCTGCTCTCCCTTCTGG + Intronic
1119573028 14:75693118-75693140 CTTCTTCCTTCTCCTCTTTCAGG - Intronic
1120749569 14:88185690-88185712 CCTCTTTCTTCTCCTCGTCCAGG + Exonic
1120752223 14:88208375-88208397 CCTCTTCTTCCTCTTCCTTGGGG + Intronic
1120771518 14:88385426-88385448 CCTCTCCCTGCTCTTCCCGCAGG + Intronic
1122047908 14:99036422-99036444 CCTTCTCCAGCTCTTTGTTCTGG + Intergenic
1122407777 14:101510422-101510444 CCTCTTCCCTCTCTTGTTTCAGG - Intergenic
1124382700 15:29180006-29180028 CTTCTTCCTGCTCCTGATTCTGG - Intronic
1124666331 15:31595964-31595986 CCTCTTCTTCCTCTTCTCTCAGG + Intronic
1124705735 15:31962466-31962488 CATATTCCTGCTCTTCTTTCAGG + Intergenic
1126897228 15:53272102-53272124 CCCTTTCCTGCTCTTCCTCCTGG + Intergenic
1127350681 15:58148963-58148985 CCTCTTCCTGATATTCTGTCAGG + Intronic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1128744038 15:70101269-70101291 CCCCTTCCTGCTCAGGGTTCAGG - Intergenic
1128792982 15:70446769-70446791 CCTTTTCCTTCTCTCAGTTCAGG + Intergenic
1129542199 15:76359557-76359579 GCTCTTCCTGCTCTGTTTTCAGG - Intronic
1130538212 15:84802129-84802151 CCTCTTCCTCCTCCTCCTCCTGG - Exonic
1130581431 15:85140594-85140616 CTTCTTCCTGCTCTCCCTTCTGG - Intergenic
1131459138 15:92606267-92606289 CCTCTTCCTGCACTGGTTTCCGG - Intergenic
1132028040 15:98419558-98419580 CCTCCTCCTTCTCCTCCTTCAGG - Intergenic
1133652116 16:7822331-7822353 GCTCTTTCTGCTCTTCCTTTGGG + Intergenic
1134060023 16:11193786-11193808 CTTCTTCCTCCTCTTCTTTTTGG + Intergenic
1135080630 16:19431627-19431649 CAACTTCCTGCTCTTGGTGCTGG + Intronic
1135177395 16:20242788-20242810 CCTCTTCCTGTTCCTCGTTCTGG - Intergenic
1136057417 16:27700705-27700727 CTTCTTCCTGCTCCTTGATCAGG - Intronic
1136080213 16:27847384-27847406 GCTCTTCCTGCTCTAAGTTCTGG - Intronic
1136396322 16:29994424-29994446 CCTCTCTCTGCTCTTTCTTCTGG + Exonic
1138229823 16:55328752-55328774 CCTCCTCCTCCTCTTCCTCCAGG - Exonic
1139388224 16:66588179-66588201 TCTCTTCCTTGTCTTCTTTCTGG + Exonic
1139397629 16:66653142-66653164 CCTCTTCCTGCTTTACTTCCTGG + Intronic
1142774263 17:2123878-2123900 TCTCTTCCTGCTCTGTTTTCAGG - Intronic
1143125498 17:4639067-4639089 TCTCTTCCAGCTCTTCTTCCCGG + Exonic
1143965568 17:10754482-10754504 CCCCTTCCTCCTCTTCCATCTGG + Intergenic
1144535425 17:16084354-16084376 CATCTTCCTTCTCTTTGTCCTGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1144802656 17:17941290-17941312 CCTCTTCCTGCACTTCCCTCTGG - Intronic
1145787809 17:27605412-27605434 GTTCTTCCTGCTCTCCTTTCAGG + Exonic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1147842983 17:43385702-43385724 CCTCTTCCTGATGATGGTTCAGG + Intergenic
1147904938 17:43816533-43816555 CCTCTTCCTGCTCTGCCAGCTGG - Intronic
1147968574 17:44207349-44207371 CCTCGTCATCCTCTTCATTCTGG + Exonic
1149766548 17:59283742-59283764 CCTCTTCCTTCTCTCAGCTCTGG - Intergenic
1150124765 17:62628714-62628736 TCTCTTCCTGCTCCTTATTCAGG + Intronic
1151228751 17:72666663-72666685 CCTGCTCCTCCTCTTCCTTCAGG + Intronic
1151642304 17:75405270-75405292 CCTCCTCCGGCTCTTGGCTCTGG - Exonic
1152228284 17:79102624-79102646 CCTCTCCCTGCTCCTCCTTGGGG + Intronic
1152956488 18:45840-45862 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1153150188 18:2083809-2083831 CCTCGGTCTGCTCTTCCTTCAGG - Intergenic
1153299442 18:3580495-3580517 CCTCTTCCTCCTCCTCCTCCTGG - Intronic
1154394611 18:13975670-13975692 CCTCCTCCTCCTCCTCCTTCTGG + Intergenic
1160804781 19:987752-987774 CCCCTTCCTGTTCTTGGCTCGGG + Intronic
1160811377 19:1014449-1014471 CCTGTTTGTGCTCTTCGTCCTGG - Exonic
1161421293 19:4177138-4177160 CCTCTTCCTGCTCTTCCCACAGG - Exonic
1161865967 19:6832448-6832470 CCTCTTCCTTCTCCTCCTTCTGG + Intronic
1163469852 19:17489728-17489750 CCTCTGCCTGCTCTCCTCTCCGG - Intronic
1164567658 19:29339469-29339491 CCTCTTCCTTCTCTTGGTTGAGG - Intergenic
1165105652 19:33468432-33468454 CCTCTTCCTCCTCCTCGGCCTGG + Intronic
1165349285 19:35267638-35267660 CCTCTTCCTCCTCCTCCTTGTGG - Exonic
1165772862 19:38388742-38388764 CCTCCTCCTCCTTTTCGTTCCGG - Intronic
1165822286 19:38684260-38684282 CCTCTTGCTGTTGTTGGTTCAGG + Intronic
1166916854 19:46201362-46201384 CCTCTTCCTGCCTTGCATTCTGG + Intergenic
1167304327 19:48698283-48698305 CCTCTTCCTTCTCTCCTTCCAGG + Intronic
1167384019 19:49153629-49153651 CTTCTTCCTCCTCCTGGTTCAGG + Exonic
1168493315 19:56829567-56829589 CCTCTTCCTGCCTTTGGCTCTGG - Intronic
925207127 2:2016278-2016300 CATCTTCTTGCTCTGTGTTCTGG - Intronic
927851736 2:26503861-26503883 CCTCTCCCTGCACCTCATTCTGG - Intronic
929452853 2:42048262-42048284 CCTCAACGTGCTCTTCGCTCCGG + Exonic
933897088 2:86821633-86821655 CCTCTGCCTGCTCTCAGTTATGG - Intronic
934853733 2:97716667-97716689 CCTCCTCATGTTATTCGTTCAGG - Intronic
938187554 2:129245211-129245233 CCTCTTCCTGCTCATCTCTCTGG + Intergenic
938210309 2:129461164-129461186 TCTCTTCTTCCTCTTGGTTCTGG - Intergenic
938308422 2:130269415-130269437 CCTATTTCTGCTCCTCCTTCAGG + Intergenic
938446907 2:131387421-131387443 CCTATTTCTGCTCCTCCTTCAGG - Intergenic
941306478 2:163875202-163875224 ACTCTTCCTGCTCTACCTTTTGG - Intergenic
942973035 2:181980264-181980286 CCTCTCCCTGCTTTTTGTTTTGG - Intronic
943051746 2:182921535-182921557 CCTCTTGGTGCTCTTGGTGCAGG - Intronic
943473752 2:188329171-188329193 TCTCTTCCTCTTCTTCCTTCAGG + Intronic
945225768 2:207530132-207530154 CCTCCTCCTGCTCCTCTTACCGG - Exonic
946056986 2:216911252-216911274 CCTGTCCCTGCCCTTCCTTCTGG + Intergenic
1168973754 20:1948862-1948884 CTCCTTCCTTCTCTTCCTTCCGG - Intergenic
1169358781 20:4929799-4929821 CCTCTTCCAGCACTGCCTTCTGG - Intronic
1170032948 20:11961307-11961329 CCTCTTCCGTTTCTTCTTTCTGG + Intergenic
1173173263 20:40744189-40744211 CCTCTTCCACCTCTTCCTTCTGG - Intergenic
1175183493 20:57164852-57164874 CCCCTTCCTCCTCCTCGTCCTGG - Intergenic
1175291503 20:57878997-57879019 CCTCTTCCTCCTCTTCCTTGTGG - Intergenic
1178512211 21:33215000-33215022 CCTCTTCCTGTTCATCCCTCAGG - Intergenic
1180037966 21:45259754-45259776 GCTCCTCCTGCCCCTCGTTCGGG + Intergenic
1180707285 22:17817564-17817586 CCTCTTCTTGCTCTTCCCACTGG + Exonic
1181009877 22:20033792-20033814 CATCTTCCTGCACTGCATTCGGG + Intronic
1181406953 22:22691836-22691858 CCCCTTCCTGCTCCTGGTACAGG - Intergenic
1181414940 22:22752600-22752622 CTTCTTCCTGCTCCTGGTTCAGG - Intronic
1181787457 22:25237476-25237498 CCTTTCCCTGCTCTTCCTCCTGG + Intergenic
1182420499 22:30246388-30246410 CCTCCTCCTCCTCCTCGCTCCGG - Intronic
1182676098 22:32041133-32041155 CCTATTCCTCCTTTTCTTTCAGG + Intergenic
1183601969 22:38844870-38844892 CCCATTCCTGCTGTTCCTTCTGG - Intergenic
1184057009 22:42059444-42059466 CCTCAGCCTGCTCTTCTCTCTGG - Exonic
1184066696 22:42125543-42125565 TGTCTTCCTGCTCTGCCTTCTGG - Intergenic
1184069164 22:42137695-42137717 TGTCTTCCTGCTCTGCCTTCTGG - Intergenic
1184978800 22:48081605-48081627 CCTCTCCCTGCTCCGCGTCCCGG + Intergenic
950063512 3:10092337-10092359 CCTCTTCCCACTCTTCCTTGGGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950773694 3:15332327-15332349 CCTCCTCCTCCTCCTCGTCCCGG + Exonic
951353579 3:21636610-21636632 CTTCTGCCTGCTTTTCATTCTGG + Intronic
952403634 3:32986171-32986193 GCTGCTCCTGCTCATCGTTCAGG + Intergenic
952464139 3:33563276-33563298 CCTCTTACTTCCCTTCTTTCTGG + Intronic
954034070 3:47841068-47841090 CCTCGTCCTCCTCTTCTTCCCGG - Exonic
955277061 3:57556651-57556673 GCTCTTCCTGCTCTTCTTGGCGG - Exonic
956368721 3:68534845-68534867 CCTGTTCCTCCTCCTCCTTCAGG - Intronic
957366191 3:79226887-79226909 CCTCCTCCTTGTCTTCCTTCCGG + Intronic
960167554 3:114420769-114420791 CCTCTTCTTCCTCTCAGTTCTGG + Intronic
960489319 3:118293266-118293288 CCTCTCCCTGCTCTGCATCCTGG + Intergenic
960682409 3:120263111-120263133 CCTCCCCCTGCTCTTCCCTCTGG - Intronic
961430079 3:126875204-126875226 CCTCTTCCTGCTCTGGATTCTGG - Intronic
964577417 3:158188481-158188503 CCTCTTCCTGCTCTATCATCTGG + Intronic
966876467 3:184324895-184324917 CCTCTTCCAGCTCTTCCTTCAGG - Exonic
968120216 3:196120636-196120658 CCCCTTCTTGATCTTCGGTCTGG - Intergenic
968357843 3:198122390-198122412 CCTTTTCCTGCTCTTAGAACAGG - Intergenic
969857923 4:10014896-10014918 CCTCTTCCTGCTCTGCCTAAAGG - Intronic
972793325 4:42393459-42393481 CCTCTTCCTGCCCTGTGTTTCGG - Intergenic
973849214 4:54944891-54944913 CCTCATCCTGCTTTCGGTTCTGG + Intergenic
975018822 4:69461619-69461641 CCTCTTTCTGCTCCTCCTACTGG + Intergenic
975394601 4:73860256-73860278 CCTATTCCATCTCTTCATTCTGG + Intergenic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
976296225 4:83474795-83474817 CCTCTTCCTGCTCTAATTACAGG - Intronic
981022875 4:140047378-140047400 CCTCTTGCTTCTCTTCTTCCTGG - Intronic
981580379 4:146243997-146244019 CCTCTTACTGGACTCCGTTCTGG + Intergenic
981690036 4:147498250-147498272 ACTTTTCCTGCTTTTTGTTCTGG + Intronic
981834288 4:149037188-149037210 CCTCTTCCTTCTCTATGCTCTGG + Intergenic
982126669 4:152189739-152189761 CCCCTTCCTGCTGTTCCCTCAGG + Intergenic
983242355 4:165247738-165247760 CCTCTTCCTCATCTTCCTTTTGG - Intronic
984457893 4:179993943-179993965 CCACTTTCTGCTTTTAGTTCAGG - Intergenic
985037125 4:185851709-185851731 CCTCTGCCTGCTTTTTATTCTGG - Intronic
986270913 5:6229976-6229998 CTGCTACCTGCTCTTCCTTCTGG + Intergenic
986975797 5:13392413-13392435 CCTCTTCCTGCTCTCCAGTTAGG + Intergenic
987261693 5:16210859-16210881 CCTCTCCCTGCTCTTCCACCTGG - Intergenic
987839467 5:23204344-23204366 CCTCTTCCTCCTCTTCCTCAGGG + Intergenic
988578134 5:32445605-32445627 CCACTTGCTGCTCTTCCTGCAGG - Intergenic
989199430 5:38748985-38749007 CCTCTTCCTTCTCTTCCTAAGGG - Intergenic
990988017 5:61659122-61659144 CCTTTCCCTGCTCTTCCTACCGG - Intronic
991042283 5:62188323-62188345 CCCCTTCCTGCTCTGTGCTCAGG - Intergenic
992328243 5:75685238-75685260 CCTGTTTCTGCTCTTGGTGCAGG - Exonic
997587314 5:135051087-135051109 CCTCTTCCTTCTCTTCCTTTTGG + Intronic
997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG + Exonic
997984404 5:138491725-138491747 CCTCATTCTGCCCTTCGTACAGG + Intergenic
998175980 5:139902383-139902405 CCTCTTCCTGCTATTTGCTAAGG + Intronic
998800772 5:145866605-145866627 CCTCAGCCTCCTCTTCCTTCTGG + Exonic
1000895309 5:166848081-166848103 AATCTTCCTGCTCTTGGTTCTGG - Intergenic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1007310178 6:40939192-40939214 ACTCTTCCTTCTCTTCTTTGTGG - Intergenic
1007599292 6:43071811-43071833 GCTCTCCCTGCCCTTCTTTCTGG + Intronic
1007620897 6:43213786-43213808 CTTCATCCTTCTCTACGTTCAGG - Exonic
1007705074 6:43785564-43785586 CCTCTTCCTGCTCCCCTTCCTGG + Exonic
1010835516 6:80583063-80583085 CCTAAACCTGCTCTTAGTTCAGG - Intergenic
1012212107 6:96532055-96532077 CTGCTTCCTGCTCTTCTCTCTGG - Intronic
1012273584 6:97244544-97244566 CTTCTGCCTGCTCTTTATTCTGG - Intronic
1013406902 6:109851489-109851511 ACTCTTCCTTATCTTCGTTGTGG - Intergenic
1014062339 6:117086198-117086220 CCTCTTCCTTCTCTTCTTCTGGG - Intergenic
1014838311 6:126185328-126185350 ACTCTTCATGCTCTTTTTTCAGG + Intergenic
1018803018 6:167237898-167237920 TCTCTTTCTGCTCTTTGCTCTGG - Intergenic
1018807564 6:167273144-167273166 TCTCTTTCTGCTCTTTGCTCTGG + Intronic
1018924454 6:168196711-168196733 CCTCTTCCTGCCTTTCCTTTGGG - Intergenic
1019551840 7:1606931-1606953 CCTCCTCCTCCTCTTCGTGCCGG + Intergenic
1019742579 7:2682211-2682233 CCTCCCCCCGCTCTTCGTGCTGG + Intronic
1020052876 7:5094074-5094096 CCTCTTTCTGCTCCTCATACTGG - Intergenic
1020057893 7:5130838-5130860 CCTCCTCCTGCTCTTCACCCCGG - Intergenic
1020279332 7:6642490-6642512 CCTCCTCCTCCTCTTCTTCCTGG - Exonic
1021365405 7:19772645-19772667 CCTCTTGGTGCTCTCCGTGCTGG - Exonic
1027560000 7:79717582-79717604 CCTGCTCCTGCTCTTCTTCCAGG - Intergenic
1028043420 7:86087912-86087934 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1028044143 7:86094021-86094043 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1028660131 7:93261787-93261809 AGTCTTCCTGCTCCTCGTTCAGG - Intronic
1029154613 7:98506560-98506582 CCTCTTTCTACTCTCCTTTCGGG - Intergenic
1029189312 7:98760598-98760620 CCTCTTCCTGGACTTTGTCCTGG + Intergenic
1029594246 7:101528423-101528445 CCTCCTCCTCCTCTTCCCTCAGG + Intronic
1030883045 7:114904791-114904813 ACTCTTCCTTATCTTCGTTATGG + Intergenic
1031597195 7:123661961-123661983 CTTCTTCCTCCTCTTCCTCCTGG - Exonic
1032675019 7:134121852-134121874 CCACTTCCTTCTCCTCTTTCAGG + Intergenic
1037816393 8:22114918-22114940 CCACTGCCTGCTCTTCGTCTGGG - Exonic
1038148170 8:24917451-24917473 CTTCTTCCTCCTCTTCTTCCTGG - Exonic
1039359930 8:36864975-36864997 CCTCCTCCAACTCTTCTTTCTGG - Intronic
1040496809 8:47972941-47972963 CCTCTGCCTGCTCCTCGCTCTGG - Exonic
1040614516 8:49020831-49020853 CTTCTTCCTGCTTTTTATTCTGG + Intergenic
1043982623 8:86658924-86658946 TCTCCTCCTGCTCTCGGTTCAGG + Intronic
1045193724 8:99908759-99908781 CCTCCTCCTTCTCTTCTCTCTGG - Intergenic
1047029114 8:120857380-120857402 CCTCTGCCTTCTCTTCCTTTGGG + Intergenic
1047203056 8:122782236-122782258 CCTCCTCCTCCTCCTCGCTCTGG - Intronic
1048489789 8:134882015-134882037 CAGCTGCCTCCTCTTCGTTCAGG - Intergenic
1049658343 8:143808731-143808753 CCTCCTCCTCCTCCTCCTTCTGG + Exonic
1049685696 8:143938439-143938461 TCTCTTCCTCCTCTTCCTTCTGG - Intronic
1051164529 9:14247820-14247842 CCTGTTCCTGCTTTTAGTTTAGG - Intronic
1054993731 9:71360862-71360884 CCTCTTCCTTCTTTTTTTTCTGG - Intronic
1056723136 9:89088738-89088760 CCTCTGCCTGCTCTCCGTGCAGG - Intronic
1059666581 9:116451994-116452016 CCTCCTCCTTCTCTTTATTCAGG + Intronic
1059754353 9:117278525-117278547 CCCCTTCCCCCTCTTCATTCAGG + Intronic
1060976375 9:127767564-127767586 CCTCTTCCTGACATTGGTTCTGG - Intronic
1061211362 9:129195299-129195321 ATTCTTCCTCCTCTTCTTTCGGG - Intergenic
1061400959 9:130368160-130368182 CCAATTCCTGCTCATCCTTCAGG - Intronic
1062356874 9:136169267-136169289 CCTCTTCCTGGGCTTCATTGAGG - Intergenic
1062451924 9:136619374-136619396 CCTCTTCCTCCTCCTCCTTCAGG - Intergenic
1185830099 X:3293283-3293305 CCTCCTCCTCCTCTTCTTGCAGG - Intergenic
1188042170 X:25381453-25381475 CTTCATCCTGGTCTTCCTTCAGG + Intergenic
1190248894 X:48707693-48707715 CTCCTACCTGCTCTACGTTCAGG + Exonic
1190589843 X:51988731-51988753 CCTCTTACTGCTCAGCGTTAGGG + Intergenic
1190850950 X:54241086-54241108 CCTCTTACTGCTCTTATTTGGGG - Intronic
1192496143 X:71617762-71617784 TCTCTCCCTGCTCTCCCTTCAGG + Intronic
1192580935 X:72280660-72280682 CCTCTGCCTCCTCCTTGTTCCGG - Intronic
1195229275 X:102829807-102829829 CATCTTCCTGCTCTCCTTCCAGG - Intergenic
1197727923 X:129788519-129788541 CATCTTCCTGTTCATGGTTCGGG - Exonic
1198816605 X:140598231-140598253 CCTCTTCTTCTTCTTCTTTCTGG - Intergenic
1199885993 X:152022447-152022469 CCTCTTCCGGCCCTGCGTTTTGG - Intergenic
1201247874 Y:12024226-12024248 CCTCCTCCTCCTCTTCTTGCAGG + Intergenic