ID: 1127773170

View in Genome Browser
Species Human (GRCh38)
Location 15:62246488-62246510
Sequence CCTCTTCCTGCTCTTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127773166_1127773170 -7 Left 1127773166 15:62246472-62246494 CCAACAACCTGAGCAACCTCTTC 0: 1
1: 0
2: 1
3: 24
4: 220
Right 1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773165_1127773170 2 Left 1127773165 15:62246463-62246485 CCTCTTGCTCCAACAACCTGAGC 0: 1
1: 0
2: 0
3: 15
4: 284
Right 1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773163_1127773170 23 Left 1127773163 15:62246442-62246464 CCTCTTGCTCCAGCAACTTCTCC 0: 1
1: 3
2: 6
3: 49
4: 573
Right 1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773162_1127773170 28 Left 1127773162 15:62246437-62246459 CCTCTCCTCTTGCTCCAGCAACT 0: 1
1: 5
2: 5
3: 62
4: 528
Right 1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG No data
1127773164_1127773170 14 Left 1127773164 15:62246451-62246473 CCAGCAACTTCTCCTCTTGCTCC 0: 1
1: 5
2: 13
3: 125
4: 839
Right 1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127773170 Original CRISPR CCTCTTCCTGCTCTTGGTTC AGG Intergenic
No off target data available for this crispr