ID: 1127774660

View in Genome Browser
Species Human (GRCh38)
Location 15:62255471-62255493
Sequence CACACGCTCCTGGCCACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127774650_1127774660 29 Left 1127774650 15:62255419-62255441 CCATTACCTGCAAGAATGGGCAC 0: 1
1: 2
2: 19
3: 9
4: 137
Right 1127774660 15:62255471-62255493 CACACGCTCCTGGCCACCTGGGG No data
1127774651_1127774660 23 Left 1127774651 15:62255425-62255447 CCTGCAAGAATGGGCACAGAAGT No data
Right 1127774660 15:62255471-62255493 CACACGCTCCTGGCCACCTGGGG No data
1127774649_1127774660 30 Left 1127774649 15:62255418-62255440 CCCATTACCTGCAAGAATGGGCA 0: 1
1: 0
2: 1
3: 9
4: 265
Right 1127774660 15:62255471-62255493 CACACGCTCCTGGCCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127774660 Original CRISPR CACACGCTCCTGGCCACCTG GGG Intergenic
No off target data available for this crispr