ID: 1127783464

View in Genome Browser
Species Human (GRCh38)
Location 15:62335856-62335878
Sequence GAGGCACTGCACCTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127783464_1127783474 15 Left 1127783464 15:62335856-62335878 CCTGAAGCCAGGTGCAGTGCCTC No data
Right 1127783474 15:62335894-62335916 GCACTTTGGAAGGCTGAGGCGGG 0: 2040
1: 66165
2: 183893
3: 235148
4: 275272
1127783464_1127783471 11 Left 1127783464 15:62335856-62335878 CCTGAAGCCAGGTGCAGTGCCTC No data
Right 1127783471 15:62335890-62335912 CCCAGCACTTTGGAAGGCTGAGG 0: 2926
1: 92327
2: 213268
3: 238724
4: 264975
1127783464_1127783469 5 Left 1127783464 15:62335856-62335878 CCTGAAGCCAGGTGCAGTGCCTC No data
Right 1127783469 15:62335884-62335906 TGCAATCCCAGCACTTTGGAAGG 0: 238
1: 15580
2: 310640
3: 264557
4: 149861
1127783464_1127783467 1 Left 1127783464 15:62335856-62335878 CCTGAAGCCAGGTGCAGTGCCTC No data
Right 1127783467 15:62335880-62335902 CACCTGCAATCCCAGCACTTTGG 0: 1503
1: 73515
2: 208423
3: 251483
4: 205012
1127783464_1127783475 29 Left 1127783464 15:62335856-62335878 CCTGAAGCCAGGTGCAGTGCCTC No data
Right 1127783475 15:62335908-62335930 TGAGGCGGGCAGATCCTTTGAGG No data
1127783464_1127783473 14 Left 1127783464 15:62335856-62335878 CCTGAAGCCAGGTGCAGTGCCTC No data
Right 1127783473 15:62335893-62335915 AGCACTTTGGAAGGCTGAGGCGG 0: 2041
1: 65801
2: 152431
3: 156620
4: 112039

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127783464 Original CRISPR GAGGCACTGCACCTGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr