ID: 1127787145

View in Genome Browser
Species Human (GRCh38)
Location 15:62365621-62365643
Sequence CTTTATTAGCAGAATGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127787143_1127787145 -6 Left 1127787143 15:62365604-62365626 CCCAGTTTTGGGTATGTCTTTAT 0: 143
1: 2489
2: 4477
3: 7680
4: 9173
Right 1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG No data
1127787144_1127787145 -7 Left 1127787144 15:62365605-62365627 CCAGTTTTGGGTATGTCTTTATT 0: 50
1: 1074
2: 3273
3: 5630
4: 7843
Right 1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG No data
1127787140_1127787145 7 Left 1127787140 15:62365591-62365613 CCTTTAAAAATTACCCAGTTTTG No data
Right 1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG No data
1127787138_1127787145 21 Left 1127787138 15:62365577-62365599 CCAGTAAACCTTTTCCTTTAAAA No data
Right 1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG No data
1127787139_1127787145 13 Left 1127787139 15:62365585-62365607 CCTTTTCCTTTAAAAATTACCCA No data
Right 1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127787145 Original CRISPR CTTTATTAGCAGAATGAGAA CGG Intergenic
No off target data available for this crispr