ID: 1127792523

View in Genome Browser
Species Human (GRCh38)
Location 15:62410994-62411016
Sequence CTATTCTTGTAGAAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127792520_1127792523 7 Left 1127792520 15:62410964-62410986 CCATGTGCTTGCTGTGGTTGTGG 0: 1
1: 0
2: 5
3: 23
4: 316
Right 1127792523 15:62410994-62411016 CTATTCTTGTAGAAGAGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 115
1127792518_1127792523 18 Left 1127792518 15:62410953-62410975 CCAGGGTACATCCATGTGCTTGC 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1127792523 15:62410994-62411016 CTATTCTTGTAGAAGAGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127792523 Original CRISPR CTATTCTTGTAGAAGAGCCC TGG Intronic
904985191 1:34540445-34540467 CTTTTCATGAAGAAAAGCCCAGG + Intergenic
906089254 1:43164483-43164505 CTTTTTCTGTAGAAGAGACCTGG - Exonic
906735083 1:48117783-48117805 CATTTCTTGTAGAACAGACCTGG - Intergenic
908675798 1:66602129-66602151 CTTTTCTAGTAGAAAATCCCAGG - Intronic
910384652 1:86667618-86667640 CATTTCTTGTAGAACAGGCCTGG - Intergenic
910512324 1:88021247-88021269 CCATTGTTGGAGATGAGCCCTGG - Intergenic
912061627 1:105679068-105679090 CTATTCTAGAAAATGAGCCCTGG - Intergenic
916071931 1:161175523-161175545 TTTTCCTTGTAGATGAGCCCTGG - Intronic
917443171 1:175084522-175084544 CTTTTCTTAAAAAAGAGCCCTGG - Intronic
919304518 1:195814080-195814102 CAATTATTGTAGAAGAGACCAGG - Intergenic
920694824 1:208174340-208174362 CTATTCTTGCAGAGGCGCCTGGG + Intronic
921184345 1:212657012-212657034 GTATTCTGGTAGCAGAGACCTGG + Intergenic
922055030 1:222033903-222033925 CTATCCTTGTAGAAGAAAGCAGG - Intergenic
923354548 1:233141167-233141189 CTAATCTTGGATAAGAGACCTGG - Intronic
1062953745 10:1526301-1526323 CTAGTCTTGTAGAGGAGGCAAGG + Intronic
1064236956 10:13585129-13585151 CTATTTTTGTAGTAGAGACAGGG + Intergenic
1064521521 10:16207958-16207980 CCCTTCTTGTAGAACAGGCCTGG + Intergenic
1067186863 10:44036592-44036614 CTATTCTTGCAAATTAGCCCTGG - Intergenic
1077548921 11:3190795-3190817 CTATTCATGGGGCAGAGCCCAGG + Intergenic
1080236398 11:30073546-30073568 CTATTCTTGTAGTAGCCCCAGGG + Intergenic
1081415609 11:42811603-42811625 CAATTTTTGTAGAAGAGAACAGG - Intergenic
1081590412 11:44419019-44419041 CTGTCCTAGTTGAAGAGCCCAGG + Intergenic
1083029271 11:59577119-59577141 CTGTTTTTGTAGAACAGCCTTGG - Intronic
1086880383 11:92146699-92146721 CCATCCGTGGAGAAGAGCCCAGG - Intergenic
1087418585 11:97890513-97890535 CTATTCATATAGATGAGGCCAGG - Intergenic
1088972472 11:114786100-114786122 CTATGCTAGTTGAGGAGCCCAGG + Intergenic
1089678846 11:120108290-120108312 CTCACCTTGTAGAAGGGCCCTGG + Intergenic
1090643250 11:128747005-128747027 CTCTTCCTGCAGAGGAGCCCTGG - Intronic
1098477436 12:70921106-70921128 CTATTCCTGTAGGCGAGTCCTGG - Intergenic
1100288044 12:93186510-93186532 CGATTCTTTCAGAAGAGCTCAGG - Intergenic
1109791940 13:67260143-67260165 CTGTTTTTGTCGAAGAGTCCTGG + Intergenic
1109985971 13:69984934-69984956 CTATTTTTTTAGTAGAGACCAGG - Intronic
1113111357 13:106827625-106827647 CTATTGGATTAGAAGAGCCCAGG - Intergenic
1113178863 13:107601445-107601467 CCATTCTTGCAGAAGAGCACAGG - Intronic
1115680847 14:35736478-35736500 CTTTTCATGTTGAAGTGCCCAGG - Intronic
1120203950 14:81567733-81567755 CCATTCTTGGGGAAGATCCCTGG - Intergenic
1122069290 14:99195287-99195309 CTTTTCTTCCAGAGGAGCCCTGG - Intronic
1127792523 15:62410994-62411016 CTATTCTTGTAGAAGAGCCCTGG + Intronic
1128549694 15:68590301-68590323 CTTTGCTTTTTGAAGAGCCCTGG + Intronic
1129608770 15:77037459-77037481 CTATAGTTGGAGAAGAGGCCTGG + Intergenic
1130974955 15:88767028-88767050 CTATACTTGTAGTAGAGACGGGG + Intergenic
1137008039 16:35296770-35296792 CTTTTCTGATGGAAGAGCCCAGG - Intergenic
1140396561 16:74632214-74632236 CTATTTTTGTAGTAGAGACGGGG - Intronic
1144338933 17:14297320-14297342 CTCTTCCCGTAGAAGGGCCCAGG - Intergenic
1149267906 17:54947756-54947778 CTTTTCTTGTTGGAGACCCCAGG + Intronic
1151425298 17:74027238-74027260 CTGTTCCTGGAGAAGAGCCAAGG - Intergenic
1152086000 17:78218973-78218995 ATATCCTTGTAGCAAAGCCCTGG + Intronic
1157708485 18:49830049-49830071 CTTTTCTTGTATAATTGCCCTGG - Intronic
1159454410 18:68642616-68642638 CTATTCCGGTTGCAGAGCCCAGG + Intergenic
1168227258 19:55004696-55004718 CTATTCTTGTGGAAGAGCTGAGG - Intergenic
925504329 2:4543941-4543963 ATATTCTTATAAAAGAGGCCTGG - Intergenic
927348109 2:22070828-22070850 CATTTCTTGTAGAACAGGCCTGG - Intergenic
932370139 2:71180076-71180098 CTGTTCTTTCAGAAGAGACCTGG - Intergenic
935920813 2:108011510-108011532 CCATCTTTGTAGAAGAGCACTGG + Exonic
936733025 2:115406919-115406941 CTATTGTTGTAGAAAAAACCGGG + Intronic
938684616 2:133725844-133725866 CATTTCTTGTAGAACAGGCCTGG + Intergenic
943886837 2:193228874-193228896 CCATACCTGTAGAAGAGCCATGG - Intergenic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
1173203998 20:40978022-40978044 CATTTCTTGTAGAACAGGCCTGG + Intergenic
1174320312 20:49736605-49736627 CTATTCTTGTGTAAGAGCATGGG - Intergenic
1174359569 20:50019517-50019539 CTAATCCTGTAGCAGAGTCCTGG + Intergenic
1178258442 21:31076566-31076588 ATATGCTCGTGGAAGAGCCCCGG - Intergenic
1182701374 22:32242235-32242257 CTATTTTTCTGGGAGAGCCCTGG - Intronic
1182928553 22:34151143-34151165 ATCTTCTTGTTGAACAGCCCTGG - Intergenic
949622896 3:5835991-5836013 CCTTTCTTGTAGAACAGGCCTGG + Intergenic
955961412 3:64344912-64344934 TTATTCTCGGAGAAGAGGCCAGG + Intronic
959127717 3:102309964-102309986 CATTTCTTGTAGAACAGGCCTGG - Intronic
961135958 3:124511544-124511566 CTCTTCTTCTAGAAGCTCCCAGG - Intronic
962390657 3:134969434-134969456 CTCTTCTCTTAGAGGAGCCCTGG + Intronic
962390945 3:134972159-134972181 CTCTTCTCTTAGAGGAGCCCTGG - Intronic
963943278 3:151116707-151116729 CTGCTATTCTAGAAGAGCCCAGG + Intronic
965492797 3:169360661-169360683 CCATTGATGGAGAAGAGCCCAGG + Intronic
965729937 3:171761127-171761149 CTATTCTTGTGAGAAAGCCCTGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967775926 3:193385993-193386015 CTATTTGTGAAGAAGATCCCCGG + Intergenic
970528423 4:16956558-16956580 CTAATGTTGGGGAAGAGCCCTGG + Intergenic
973745748 4:53961760-53961782 CTATACTTTTAGAAGATCACAGG + Intronic
976291834 4:83426736-83426758 GTATTCTTTTAGAAGAGACGGGG + Intronic
976388849 4:84489188-84489210 CTTTTCTTGGAAAAGAGACCGGG - Intergenic
976651827 4:87443785-87443807 ATATTCTTGTAGAAGAGTAGTGG + Intronic
977209059 4:94196648-94196670 CAATTTTTGTAGAAGAAGCCAGG - Intergenic
977506631 4:97911300-97911322 CCATTCCTGTAGAAAAGCCAGGG + Intronic
977523472 4:98115385-98115407 TTCTTCTTTTAGAAGAGCCCAGG - Intronic
978338140 4:107691670-107691692 CTATACTTGTAGAAGAGCACAGG - Intronic
979277622 4:118831199-118831221 CTATTTTTTTAGTAGAGACCGGG + Intronic
980597112 4:134968540-134968562 CTTTTCTTGTAGAATAGGACTGG - Intergenic
983533752 4:168835895-168835917 CCATTCTTGTAGAAAAGACATGG + Intronic
992432427 5:76722330-76722352 CTTTTCTTGGAGAACAGACCTGG + Intronic
992610914 5:78507821-78507843 TTAATCCTGTTGAAGAGCCCTGG - Intronic
993429665 5:87815948-87815970 CTATTTTTGTACCAGAGCCATGG + Intergenic
1000663699 5:163968459-163968481 TTATTCTTGCAGAAGAGAACAGG + Intergenic
1003842187 6:10133845-10133867 CTATCCATGAAGAAAAGCCCAGG + Intronic
1005858962 6:29887286-29887308 GTTTTCTTCTAGAAGAGTCCAGG + Intergenic
1005866514 6:29942067-29942089 TTTTTCTTCTAGAAGAGTCCAGG + Exonic
1007652896 6:43434166-43434188 CTATTCCTGTAGAAGTACACAGG - Intronic
1009352940 6:62705693-62705715 CATTTCTTGTAGAATAGACCCGG + Intergenic
1011019186 6:82791501-82791523 CAATTCTTGTAGGACAGTCCTGG - Intergenic
1020512493 7:9075349-9075371 CTATTCTTGTACCAGTGCCATGG + Intergenic
1021141059 7:17026071-17026093 CTTTTCTTGTAGAAGAAGCAGGG + Intergenic
1021355755 7:19651612-19651634 CTCTTCTTGGTGAAGAGCCAGGG - Intergenic
1026439931 7:70435282-70435304 CTTTTCCTGTAGAAAAGCACCGG + Intronic
1027821266 7:83048263-83048285 GTATTCTTGTTTAAGAGCTCTGG - Intronic
1028108002 7:86902908-86902930 ATATTCTTGTAGAAGACACTGGG - Intronic
1035431087 7:158822588-158822610 TTATACTTGTAGTAGAGCCGAGG - Intronic
1043421639 8:80104319-80104341 CCATTCTTTTAGAAGAGCTTAGG - Intronic
1044256683 8:90071505-90071527 GTATTATTATAGAAGAGGCCAGG - Intronic
1044664817 8:94624147-94624169 CTCTCCTGGTAGAAGAGCTCAGG - Intergenic
1045483198 8:102609407-102609429 CTATTTTTGTAGTAGAGACGGGG + Intergenic
1045666017 8:104485618-104485640 CTATTCCTGAAGAAGAGTTCAGG + Intergenic
1048645895 8:136418671-136418693 GTATTCTAGTAGTGGAGCCCAGG - Intergenic
1048645901 8:136418717-136418739 GTATTCTAGTAGTGGAGCCCAGG + Intergenic
1059099891 9:111460295-111460317 CTATTCATGTTGAAGAGACAAGG + Intronic
1059586846 9:115616437-115616459 CTATTCTTGTACATGACCCTTGG - Intergenic
1185781049 X:2847008-2847030 CTTATCTTGTAGAAAGGCCCTGG + Intronic
1188844199 X:35053527-35053549 GTATTTTTGTAGAAGAGACGGGG + Intergenic
1190015356 X:46821792-46821814 CTTTTCTTGTAGGACAGGCCTGG - Intergenic
1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG + Intergenic
1193212392 X:78822506-78822528 GCATTCTTGTAGAGCAGCCCAGG + Intergenic
1193983859 X:88216685-88216707 CTATTCTTCTAGAAGCACTCTGG - Intergenic
1196659261 X:118252827-118252849 CTATACTTGTAGAAGAAAACTGG - Intergenic
1201289035 Y:12404662-12404684 CTTATCTTGTAGAAAGGCCCTGG - Intergenic